GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-04 11:43:56, GGGenome : Penicillium marneffei (ATCC 18224) genome, JCVI-PMFA1-2.0 (Oct, 2008)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

NW_002196665.1 Penicillium marneffei ATCC 18224 scf_1105668340984, whole genome shotgun sequence
position: 2505991-2506005
CGGCCAGATATACTGTCTAGGTGGCATTCC2505991TTCATTGACAACATTTTCGCCAAAATACCGCTCACCGTATCCCTC
NW_002196664.1 Penicillium marneffei ATCC 18224 scf_1105668340752, whole genome shotgun sequence
position: 2196758-2196772
CGTGACGAGGAAGGTCAGGACGTGCTTCTC2196758TTCATTGACAACATTTTCCGTTTCACTCAGGCCGGTTCTGAGGTG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/JCVI_PMFA1_2.0/TTCATTGACAACATT
lang : en | db : JCVI_PMFA1_2.0 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.078 | 0.071 | search_plus_done; http://172.18.8.72:28260/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.083 | 0.005 | search_minus_done; http://172.18.8.72:28260/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=48
0.083 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).