GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2024-05-26 15:35:39, GGGenome : Human Japanese Reference Genome, JG1 (JG1.0.0beta) (Feb, 2019)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr1:82193652-82193666
CTAATTAATGAATAGTAAGTATATTTTCTC82193652TTCATTGACAACATTTTTCCTCTTACTTTATTGTAAGAATACAAT
chr2:156556756-156556770
ATTGCAGCAAAGAAGCACATTTATATTCTA156556756TTCATTGACAACATTAGCATATAATGCAAATTTACTTTGGAACTT
chr3:15266545-15266559
ATTGTAATAGCCAGAAATTGGAAACATATA15266545TTCATTGACAACATTTAAGATTATAATATAGTCATATAATAGTCC
chr3:84630006-84630020
TTGGTTTTGTATATATTAAATAGTTGAAAC84630006TTCATTGACAACATTAAGTTTGTTTTCTAGGCTCTATTGGGATAA
chr4:15398692-15398706
AACGAAAGGCGTTTGAGGAAAGCCTGATAA15398692TTCATTGACAACATTACCATCAACCACACCTTACCATTCCTAGGA
chr4:61636268-61636282
TCTTCAAATATTTTACAGAGTTCAACTCTT61636268TTCATTGACAACATTATGACATTATGCTGATTGGATCCAGTGAGT
chr4:147837180-147837194
CAGAATATATTATCGCTTTAAACACAGATT147837180TTCATTGACAACATTTTGTGGGCACCCATTTAATATTAATATTAA
chr4:164769073-164769087
AAAAACGTCTGATTTTGTGTAACACTCCTT164769073TTCATTGACAACATTAAACAGCAATTAACTATTTGCTGATTACAT
chr6:63311284-63311298
CTATTTCAATCAACCATCTTGTAATCATAC63311284TTCATTGACAACATTTTACTCATACTATAATAAGTTGCTATTTCT
chr7:3516784-3516798
GTGGTGCCTGGCCTGAGTCAGCTCATTAGC3516784TTCATTGACAACATTGGTTCGTTCAACAAATATTGCCTGAGAAGA
chr8:30085029-30085043
GTATTTTTAAATTCATCGATATTTCCACTT30085029TTCATTGACAACATTATTAAGTTTTATTGTGTCTCTTTTTTCAAA
chr11:24385229-24385243
TTGAGTTTCCTGGAACATAGATATGTCTTG24385229TTCATTGACAACATTCTAGCATTGAGGACAGTGAATAGAGAAAAG
chr13:81762172-81762186
GCAGTCTGGAGGTTCTCCCTGGAGGCTGTA81762172TTCATTGACAACATTTCCTGAGGTAACTCACACTGAGGTGACAAC
chr18:26984782-26984796
ATATTTATATATGTATATATTTCATATTAT26984782TTCATTGACAACATTTACTTGGGAGATTTGTCTCAACAAAAATTA
chr19:41222799-41222813
AAGCCACCACACCCGGCCTATCTTAGCTTT41222799TTCATTGACAACATTAGTATAATGTTAACAGCTCTCCTAAGGGAG
chr2:192407084-192407098
AATGCCCCACATTTCATTAAGGGTGATGAC192407084AATGTTGTCAATGAAGAAGTTGCTTCTCATATAACTATACTGTCA
chr3:57256108-57256122
GCCTGTTTTTCATATGCATATGTAATAGGG57256108AATGTTGTCAATGAAAACACAATAGTATTTGGAGTGCAGCATAGT
chr3:97421811-97421825
AATTTGAATATTAATTTTAAAATTTATTCA97421811AATGTTGTCAATGAACATTGTCAGACATTTTGCAGCATTTCTTTA
chr5:10371817-10371831
GAGGGCCTTTCCAGCTCCAAAGTCGATGGC10371817AATGTTGTCAATGAAAGATCAGCAGATCAGTGCATTATACCCAGG
chr7:34145923-34145937
TCTACAGATTTTGGATTTACCAGCCCCCAC34145923AATGTTGTCAATGAATTCCTTAAAATCTCTCTCTCTCTCTCTCTC
chr7:77405138-77405152
AACTAACACCCATAAAAGGTATGACTCTTT77405138AATGTTGTCAATGAAGATTTAACATAATATTCTATAACAAATATA
chr12:79423102-79423116
ATAAGATAGGTTTGTTCCAGAAGTTTAAAA79423102AATGTTGTCAATGAATTTGATAAAGTTTAATATTCACATTAAAAG
chr19:41053591-41053605
CTCCCTTAGGAGAGCTGTTAACATTATACT41053591AATGTTGTCAATGAAAAAGCTAAGATAGGCCAGGCATGGTGGCTC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/JG1/TTCATTGACAACATT
lang : en | db : JG1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.009 | 0.009 | search_start;
0.083 | 0.074 | search_plus_done; http://172.18.8.72:28793/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.097 | 0.014 | search_minus_done; http://172.18.8.72:28793/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=35
0.102 | 0.005 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).