GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-08-14 23:59:20, GGGenome : Human Japanese Reference Genome, JG1 (JG1.0.0beta) (Feb, 2019)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr1
position: 82193652-82193666
CTAATTAATGAATAGTAAGTATATTTTCTC82193652TTCATTGACAACATTTTTCCTCTTACTTTATTGTAAGAATACAAT
chr2
position: 156556756-156556770
ATTGCAGCAAAGAAGCACATTTATATTCTA156556756TTCATTGACAACATTAGCATATAATGCAAATTTACTTTGGAACTT
chr3
position: 15266545-15266559
ATTGTAATAGCCAGAAATTGGAAACATATA15266545TTCATTGACAACATTTAAGATTATAATATAGTCATATAATAGTCC
chr3
position: 84630006-84630020
TTGGTTTTGTATATATTAAATAGTTGAAAC84630006TTCATTGACAACATTAAGTTTGTTTTCTAGGCTCTATTGGGATAA
chr4
position: 15398692-15398706
AACGAAAGGCGTTTGAGGAAAGCCTGATAA15398692TTCATTGACAACATTACCATCAACCACACCTTACCATTCCTAGGA
chr4
position: 61636268-61636282
TCTTCAAATATTTTACAGAGTTCAACTCTT61636268TTCATTGACAACATTATGACATTATGCTGATTGGATCCAGTGAGT
chr4
position: 147837180-147837194
CAGAATATATTATCGCTTTAAACACAGATT147837180TTCATTGACAACATTTTGTGGGCACCCATTTAATATTAATATTAA
chr4
position: 164769073-164769087
AAAAACGTCTGATTTTGTGTAACACTCCTT164769073TTCATTGACAACATTAAACAGCAATTAACTATTTGCTGATTACAT
chr6
position: 63311284-63311298
CTATTTCAATCAACCATCTTGTAATCATAC63311284TTCATTGACAACATTTTACTCATACTATAATAAGTTGCTATTTCT
chr7
position: 3516784-3516798
GTGGTGCCTGGCCTGAGTCAGCTCATTAGC3516784TTCATTGACAACATTGGTTCGTTCAACAAATATTGCCTGAGAAGA
chr8
position: 30085029-30085043
GTATTTTTAAATTCATCGATATTTCCACTT30085029TTCATTGACAACATTATTAAGTTTTATTGTGTCTCTTTTTTCAAA
chr11
position: 24385229-24385243
TTGAGTTTCCTGGAACATAGATATGTCTTG24385229TTCATTGACAACATTCTAGCATTGAGGACAGTGAATAGAGAAAAG
chr13
position: 81762172-81762186
GCAGTCTGGAGGTTCTCCCTGGAGGCTGTA81762172TTCATTGACAACATTTCCTGAGGTAACTCACACTGAGGTGACAAC
chr18
position: 26984782-26984796
ATATTTATATATGTATATATTTCATATTAT26984782TTCATTGACAACATTTACTTGGGAGATTTGTCTCAACAAAAATTA
chr19
position: 41222799-41222813
AAGCCACCACACCCGGCCTATCTTAGCTTT41222799TTCATTGACAACATTAGTATAATGTTAACAGCTCTCCTAAGGGAG
chr2
position: 192407084-192407098
AATGCCCCACATTTCATTAAGGGTGATGAC192407084AATGTTGTCAATGAAGAAGTTGCTTCTCATATAACTATACTGTCA
chr3
position: 57256108-57256122
GCCTGTTTTTCATATGCATATGTAATAGGG57256108AATGTTGTCAATGAAAACACAATAGTATTTGGAGTGCAGCATAGT
chr3
position: 97421811-97421825
AATTTGAATATTAATTTTAAAATTTATTCA97421811AATGTTGTCAATGAACATTGTCAGACATTTTGCAGCATTTCTTTA
chr5
position: 10371817-10371831
GAGGGCCTTTCCAGCTCCAAAGTCGATGGC10371817AATGTTGTCAATGAAAGATCAGCAGATCAGTGCATTATACCCAGG
chr7
position: 34145923-34145937
TCTACAGATTTTGGATTTACCAGCCCCCAC34145923AATGTTGTCAATGAATTCCTTAAAATCTCTCTCTCTCTCTCTCTC
chr7
position: 77405138-77405152
AACTAACACCCATAAAAGGTATGACTCTTT77405138AATGTTGTCAATGAAGATTTAACATAATATTCTATAACAAATATA
chr12
position: 79423102-79423116
ATAAGATAGGTTTGTTCCAGAAGTTTAAAA79423102AATGTTGTCAATGAATTTGATAAAGTTTAATATTCACATTAAAAG
chr19
position: 41053591-41053605
CTCCCTTAGGAGAGCTGTTAACATTATACT41053591AATGTTGTCAATGAAAAAGCTAAGATAGGCCAGGCATGGTGGCTC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/JG1/TTCATTGACAACATT
lang : en | db : JG1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.078 | 0.072 | search_plus_done; http://172.18.8.72:28793/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.090 | 0.011 | search_minus_done; http://172.18.8.72:28793/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=35
0.094 | 0.004 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).