GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-05-19 09:10:01, GGGenome : Human Japanese Reference Genome, JRGv2 (Jun, 2017)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr1
position: 83221488-83221502
CTAATTAATGAATAGTAAGTATATTTTCTC83221488TTCATTGACAACATTTTTCCTCTTACTTTATTGTAAGAATACAAT
chr2
position: 160602807-160602821
ATTGCAGCAAAGAAGCACATTTATATTCTA160602807TTCATTGACAACATTAGCATATAATGCAAATTTACTTTGGAACTT
chr3
position: 15269641-15269655
ATTGTAATAGCCAGAAATTGGAAACATATA15269641TTCATTGACAACATTTAAGATTATAATATAGTCATATAATAGTCC
chr3
position: 84704196-84704210
TTGGTTTTGTATATATTAAATAGTTGAAAC84704196TTCATTGACAACATTAAGTTTGTTTTCTAGGCTCTATTGGGATAA
chr4
position: 16164477-16164491
AACGAAAGGCGTTTGAGGAAAGCCTGATAA16164477TTCATTGACAACATTACCATCAACCACACCTTACCATTCCTAGGA
chr4
position: 62299265-62299279
TCTTCAAATATTTTACAGAGTTCAACTCTT62299265TTCATTGACAACATTATGACATTATGCTGATTGGATCCAGTGAGT
chr4
position: 149150088-149150102
CAGAATATATTATCGCTTTAAACACAGATT149150088TTCATTGACAACATTTTGTGGGCACCCATTTAATATTAATATTAA
chr4
position: 166068335-166068349
AAAAACGTCTGATTTTGTGTAACACTCCTT166068335TTCATTGACAACATTAAACAGCAATTAACTATTTGCTGATTACAT
chr6
position: 62092968-62092982
CTATTTCAATCAACCATCTTGTAATCATAC62092968TTCATTGACAACATTTTACTCATACTATAATAAGTTGCTATTTCT
chr7
position: 3535169-3535183
GTGGTGCCTGGCCTGAGTCAGCTCATTAGC3535169TTCATTGACAACATTGGTTCGTTCAACAAATATTGCCTGAGAAGA
chr8
position: 31551104-31551118
GTATTTTTAAATTCATCGATATTTCCACTT31551104TTCATTGACAACATTATTAAGTTTTATTGTGTCTCTTTTTTCAAA
chr11
position: 24566555-24566569
TTGAGTTTCCTGGAACATAGATATGTCTTG24566555TTCATTGACAACATTCTAGCATTGAGGACAGTGAATAGAGAAAAG
chr13
position: 84286347-84286361
GCAGTCTGGAGGTTCTCCCTGGAGGCTGTA84286347TTCATTGACAACATTTCCTGAGGTAACTCACACTGAGGTGACAAC
chr18
position: 29618845-29618859
ATATTTATATATGTATATATTTCATATTAT29618845TTCATTGACAACATTTACTTGGGAGATTTGTCTCAACAAAAATTA
chr19
position: 41212742-41212756
AAGCCACCACACCCGGCCTATCTTAGCTTT41212742TTCATTGACAACATTAGTATAATGTTAACAGCTCTCCTAAGGGAG
chr2
position: 196491420-196491434
AATGCCCCACATTTCATTAAGGGTGATGAC196491420AATGTTGTCAATGAAGAAGTTGCTTCTCATATAACTATACTGTCA
chr3
position: 57292561-57292575
GCCTGTTTTTCATATGCATATGTAATAGGG57292561AATGTTGTCAATGAAAACACAATAGTATTTGGAGTGCAGCATAGT
chr3
position: 97644854-97644868
AATTTGAATATTAATTTTAAAATTTATTCA97644854AATGTTGTCAATGAACATTGTCAGACATTTTGCAGCATTTCTTTA
chr5
position: 9785641-9785655
GAGGGCCTTTCCAGCTCCAAAGTCGATGGC9785641AATGTTGTCAATGAAAGATCAACAGATCAGTGCATTATACCCAGG
chr7
position: 34175603-34175617
TCTACAGATTTTGGATTTACCAGCCCCCAC34175603AATGTTGTCAATGAATTCCTTAAAATCTCTCTCTCTCTCTCTCTC
chr7
position: 78863678-78863692
AACTAACACCCATAAAAGGTATGACTCTTT78863678AATGTTGTCAATGAAGATTTAACATAATATTCTATAACAAATATA
chr12
position: 79276150-79276164
ATAAGATAGGTTTGTTCCAGAAGTTTAAAA79276150AATGTTGTCAATGAATTTGATAAAGTTTAATATTCACATTAAAAG
chr19
position: 41043557-41043571
CTCCCTTAGGAGAGCTGTTAACATTATACT41043557AATGTTGTCAATGAAAAAGCTAAGATAGGCCAGGCATGGTGGCTC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/JRGv2/TTCATTGACAACATT
lang : en | db : JRGv2 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.079 | 0.071 | search_plus_done; http://172.18.8.72:28263/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.091 | 0.012 | search_minus_done; http://172.18.8.72:28263/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=35
0.095 | 0.004 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).