GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-03-03 01:55:20, GGGenome : Spotted gar genome, LepOcu1 (Dec, 2011)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

LG1 dna:chromosome chromosome:LepOcu1:LG1:1:69065196:1 REF
position: 31843078-31843092
CTAATAAAATAATAATATGGTATGAGTTGC31843078TTCATTGACAACATTTTAAAGAAAATATTCCCATTCAGGTGCCTT
LG9 dna:chromosome chromosome:LepOcu1:LG9:1:53241385:1 REF
position: 45885692-45885706
ATTTGCCCTACATCTGAGGTGTGCAATGAG45885692TTCATTGACAACATTGACTGCAATGTTAAAAATATATACTGTATT
LG27 dna:chromosome chromosome:LepOcu1:LG27:1:15260519:1 REF
position: 11377710-11377724
CAGGTCAAACTCTTGCAAAGCCTTTTCCTT11377710TTCATTGACAACATTGCTGATGGAACTCAACTGACTCTGGAGTGA
LG2 dna:chromosome chromosome:LepOcu1:LG2:1:68575853:1 REF
position: 21241507-21241521
AAATCAGCTAAATTAATGTTCTAGACACAG21241507AATGTTGTCAATGAATTCAGAACTGTTTACAAAGGTTCACTGTAG
LG4 dna:chromosome chromosome:LepOcu1:LG4:1:73198282:1 REF
position: 33899358-33899372
TGGAATAGTGAGCTCATATACAGTATGAAC33899358AATGTTGTCAATGAAATGCATTGATGGGGTTTAAATGTCAATTCT
LG4 dna:chromosome chromosome:LepOcu1:LG4:1:73198282:1 REF
position: 36510767-36510781
CTTGGTTTTTAGCAAAACAGTATAAAGAAA36510767AATGTTGTCAATGAAGCTAATATTCCTTTAATGAGCATTTTACAG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/LepOcu1/TTCATTGACAACATT
lang : en | db : LepOcu1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
3.213 | 3.206 | search_plus_done; http://172.18.8.76:28129/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
3.224 | 0.011 | search_minus_done; http://172.18.8.76:28129/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=47
3.226 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).