GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2022-12-08 12:58:50, GGGenome : Musa acuminata genome, MA1 (Aug, 2012)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

2 dna:chromosome chromosome:MA1:2:1:22054697:1
position: 221480-221494
TAACACTTTTACAAGGTATATCCATTTCAG221480TTCATTGACAACATTTCATTACATACAAAATATGCTTATACAACA
3 dna:chromosome chromosome:MA1:3:1:30470407:1
position: 24998806-24998820
TGAGTAAAAGTAGTTCCCAGTAACAGTCAT24998806TTCATTGACAACATTGATTCCATAAATTTTGCTTCTTTCTCAGTG
6 dna:chromosome chromosome:MA1:6:1:34899179:1
position: 9193103-9193117
GAACTCGTAGCGTATACTAACTACATTGTT9193103TTCATTGACAACATTAGTCCACCAGATCCTTCTTTCAAGACCGCA
10 dna:chromosome chromosome:MA1:10:1:33665772:1
position: 12672301-12672315
TAACACTTTTATATGGTATATCCATTTTGA12672301TTCATTGACAACATTTCATAACGTACAAAATATGCTTATACAATA
chrUn_random dna:chromosome chromosome:MA1:chrUn_random:1:141147818:1
position: 28896843-28896857
TAACACTTTTACATAATATATCCATTCAGA28896843TTCATTGACAACATTGTCATTACATAAAGAATATGCTTATTCAAC
chrUn_random dna:chromosome chromosome:MA1:chrUn_random:1:141147818:1
position: 73198684-73198698
TAACACTTTTACCTAGTATATCCATTTCGA73198684TTCATTGACAACATTTTATTTCATACAAAATATGCTTATACAACA
chrUn_random dna:chromosome chromosome:MA1:chrUn_random:1:141147818:1
position: 107206998-107207012
TAACACTTTTACACAGTATATCCATTTCGA107206998TTCATTGACAACATTTCATTACATACAAAATATGCTTATACAACA
chrUn_random dna:chromosome chromosome:MA1:chrUn_random:1:141147818:1
position: 126508316-126508330
TAACACTTTTACATAGTATATCCATTTCGA126508316TTCATTGACAACATTTCATTTCATATAAAATATGCTTATACAATA
1 dna:chromosome chromosome:MA1:1:1:27573629:1
position: 23858587-23858601
TGGTGTATAAGTACAATTTGTATATAATGA23858587AATGTTGTCAATGAATATGAATTAATGTATCATGTAAAAGCTTTA
4 dna:chromosome chromosome:MA1:4:1:30051516:1
position: 25133131-25133145
TCTTTTGAACAGAGAGTATGCCCCATTAAG25133131AATGTTGTCAATGAAATTGACCCCAGTGAGTTGCATGAGATCCTT
5 dna:chromosome chromosome:MA1:5:1:29377369:1
position: 24212756-24212770
ATAATGACTACGGTTGCTCATGTTTCAAAC24212756AATGTTGTCAATGAAGAGAAACTTAATTATTTTATTAGGACATCA
8 dna:chromosome chromosome:MA1:8:1:35439739:1
position: 6565042-6565056
ATCCCAAGTCAGACTCCCATCAATCAGAAC6565042AATGTTGTCAATGAACAATATACAGCACAGAAGTTCAATGATGAT
9 dna:chromosome chromosome:MA1:9:1:34148863:1
position: 18365428-18365442
TGTTGTATAAGCATATTTTGTATGTAATGA18365428AATGTTGTCAATGAATCAAAATGGATATACTGTGTAAAAGTGTTA
10 dna:chromosome chromosome:MA1:10:1:33665772:1
position: 4533677-4533691
TGTTGTATAAGTATATTTTGTGTGTAATGA4533677AATGTTGTCAATGAACCGAAATGGATATACCTTATAAAAATGTTA
10 dna:chromosome chromosome:MA1:10:1:33665772:1
position: 8717064-8717078
TTGTTATATAAGTGCATTTGTATCTAATGA8717064AATGTTGTCAATGAATAATTGTTGTATAATGTAAAAGTAAAGCTT
chrUn_random dna:chromosome chromosome:MA1:chrUn_random:1:141147818:1
position: 1763091-1763105
TATAAGTGCATTTTATATGAAATGAAATGA1763091AATGTTGTCAATGAATCTGAATTGATACATTGTGTAAAAGTGTTA
chrUn_random dna:chromosome chromosome:MA1:chrUn_random:1:141147818:1
position: 63840866-63840880
TGTTGTATAAGCATATTTTATATGTAATGA63840866AATGTTGTCAATGAATCGAAATGGTTATACTGTGTAAAAGTGTTA
chrUn_random dna:chromosome chromosome:MA1:chrUn_random:1:141147818:1
position: 66350704-66350718
TGTTGTATAAGAATATTTGGTATGTAATGA66350704AATGTTGTCAATGAATCGAAATGGATATACCTTGTAAAAGTGTTA
chrUn_random dna:chromosome chromosome:MA1:chrUn_random:1:141147818:1
position: 79355150-79355164
TGTTGTATAAGCATATTTTGTATGAAATGA79355150AATGTTGTCAATGAATCGAAATGGATATACTATGTAAAAGTGTTA
chrUn_random dna:chromosome chromosome:MA1:chrUn_random:1:141147818:1
position: 103841615-103841629
TGTTGTATAAGCATATTTTGTATGTAATGA103841615AATGTTGTCAATGAATCGAAATGGATATACTATGTAAAAGTGTTA
chrUn_random dna:chromosome chromosome:MA1:chrUn_random:1:141147818:1
position: 128737657-128737671
TATGGTATAAGCATATTTTGTATGTAATGA128737657AATGTTGTCAATGAACCAAAATGGATATATCTTGTAAAAGTGTTA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/MA1/TTCATTGACAACATT
lang : en | db : MA1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.081 | 0.073 | search_plus_done; http://172.18.8.75:28180/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.090 | 0.009 | search_minus_done; http://172.18.8.75:28180/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=42
0.098 | 0.007 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).