GGGenome | Results

Help | Japanese

2025-04-08 06:27:18, GGGenome : Magnaporthe oryzae (70-15) genome, MG8 (Sep, 2011)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and in~~dels~~ are marked in red.

4 dna:chromosome chromosome:MG8:4:1:5546968:1
position: 2781118-2781132

TTCAGGAACGAGGGCCAGGATGTGCTCCTG2781118TTCATTGACAACATTTTCCGGTAAATATCTCATCTTGTAAACCCT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Tab-delimited text: Open in new window | Download
You can copy-paste the result into spreadsheet softwares (e.g. Excel) or text editors.
CSV format: Open in new window | Download
You can open CSV files using spreadsheet softwares (e.g. Excel) or text editors.
BED format: Link | Download
GFF format: Link | Download
JSON format: Link | Download

Debug Info:

0.008 | 0.008 | search_start;
0.079 | 0.070 | search_plus_done; http://172.18.8.77:28223/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.082 | 0.004 | search_minus_done; http://172.18.8.77:28223/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.083 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).