GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-01 11:37:17, GGGenome : Mouse genome, MSMv3

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr2
position: 131291594-131291608
AGACAAATTAAGACTGTATTGTATCATGGT131291594TTCATTGACAACATTTAAAATTGTTACATATTTCAAAATTTTTTA
chr6
position: 141355378-141355392
AAAGTACTATCAGTTTCCTAAATATATCCA141355378TTCATTGACAACATTGTTCACTCTTCCATAAACATCTGCTAGTTA
chr6
position: 146108625-146108639
TGAACACATTCTCCCTGTTTGTGTCATCAC146108625TTCATTGACAACATTTAACTGGGCCTTCTGTGTGGATACCATGAT
chr10
position: 46777408-46777422
TATTTCTTTCTGTTTGTTTATATGATGGAC46777408TTCATTGACAACATTTCATATATGTAACCATCCTGTATCTCTGTA
chr14
position: 109630942-109630956
TGCTGCTGGAATCTCTCCCTGGAGGGTGTG109630942TTCATTGACAACATTGCCCACTGAGAGTGACAACCTCAGCAGCCA
chr1
position: 32438447-32438461
TTTTTAAAGACAGCAGGAAATAGCAAATAA32438447AATGTTGTCAATGAACAGTGTTTCCAAATGGTACATTAAGTATTC
chr2
position: 47183896-47183910
ATATCTATTTATTCATTGATGTAGCTTTCA47183896AATGTTGTCAATGAACACTGTTACTTCGTTGAGCACATGAAAAGT
chr3
position: 39215355-39215369
GTTGCCCCAGATTCAAGCTGCATGTTGACC39215355AATGTTGTCAATGAACTTCAACTACAAGTTCTGAGGCAGAATCTA
chr3
position: 42577417-42577431
TTAAACATCAGAGAAATGAAAAATAAGTAA42577417AATGTTGTCAATGAATAAACATCCCTGTAAGTTAAGGTTTGCAAT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/MSMv3/TTCATTGACAACATT
lang : en | db : MSMv3 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.092 | 0.085 | search_plus_done; http://172.18.8.72:28265/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.102 | 0.011 | search_minus_done; http://172.18.8.72:28265/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=45
0.104 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).