GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-01 02:26:27, GGGenome : Crab-eating macaque genome, MacFas5.0 (Jun, 2013)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

5 dna:chromosome chromosome:MacFas_5.0:5:1:189454096:1 REF
position: 148104515-148104529
CAGAATATATTATCGCTTTGAACACAGATT148104515TTCATTGACAACATTTTGTGGGCATCCATTTAATATTAATATTAA
5 dna:chromosome chromosome:MacFas_5.0:5:1:189454096:1 REF
position: 165086432-165086446
TAAAACCTCTGATTTTGTGTAACACTCCTT165086432TTCATTGACAACATTAAACAGCAATTAACTATTTGCTGACTACAT
5 dna:chromosome chromosome:MacFas_5.0:5:1:189454096:1 REF
position: 180823962-180823976
TTTGGACCCCCAGATCAGTCTTCATATTCT180823962TTCATTGACAACATTCATGAAGTTCTGCAGAAATTAGATAGAATT
5 dna:chromosome chromosome:MacFas_5.0:5:1:189454096:1 REF
position: 185708646-185708660
GCCTGAGCCACCATGCCCAGCTTGCTATTC185708646TTCATTGACAACATTCACTTAAACAAACATCCATAAAATTAAGTC
16 dna:chromosome chromosome:MacFas_5.0:16:1:80997621:1 REF
position: 14308050-14308064
GCCTCTGGGCCTATATTAGATGGGCCATGC14308050TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
17 dna:chromosome chromosome:MacFas_5.0:17:1:96864807:1 REF
position: 49623721-49623735
TGTTCAAAGTTTTCCCCTCCAATGTATCTT49623721TTCATTGACAACATTCGGATTTATCACATCAATCAGTCAATAAAT
17 dna:chromosome chromosome:MacFas_5.0:17:1:96864807:1 REF
position: 66800600-66800614
GCAGTCTGGAGGTTCTCCCTGGAGGCTGTA66800600TTCATTGACAACATTGCCTGAGGTAACTCACACTGAGGTGACAAC
19 dna:chromosome chromosome:MacFas_5.0:19:1:59248254:1 REF
position: 41605405-41605419
GTGAGCCACCATGCTGGCCTATCTTAGCTT41605405TTCATTGACAACATTAGTATAATGTTAACAGCTCTCCTAAGGGAA
2 dna:chromosome chromosome:MacFas_5.0:2:1:192460366:1 REF
position: 112525772-112525786
GCCTGTTTTTCATATGCATATGTAATAGGG112525772AATGTTGTCAATGAAAACACAATAGTATTTGGAGTGCAGCATAGT
6 dna:chromosome chromosome:MacFas_5.0:6:1:181584905:1 REF
position: 9837729-9837743
GAGGGCCTTTCCAGCTCCAAGGTCAATGGC9837729AATGTTGTCAATGAAAGATCAGCAGGTCAGTGCCTTATACCCAGA
11 dna:chromosome chromosome:MacFas_5.0:11:1:137757926:1 REF
position: 78340619-78340633
GTAAGATAGGTTTGTTCCAGAAGTTTAAAA78340619AATGTTGTCAATGAATTTGATAAAATTTAATATTCACATTAGAAG
14 dna:chromosome chromosome:MacFas_5.0:14:1:130733371:1 REF
position: 43025544-43025558
GTTTGCTCTATTCACTGTCCTCAACGCTAG43025544AATGTTGTCAATGAACAAGACATATCTATGTTCCTGGAAACTCAA
19 dna:chromosome chromosome:MacFas_5.0:19:1:59248254:1 REF
position: 41387425-41387439
ACTCCCTTAGGAGAGCTGTAACATTATACT41387425AATGTTGTCAATGAAAAGCTAAGACAGGCCAGGGGTGGTGGCTCA
19 dna:chromosome chromosome:MacFas_5.0:19:1:59248254:1 REF
position: 41444775-41444789
CTCCCTTAGGAGAGCCGTTAACATTATACT41444775AATGTTGTCAATGAAAAAGCTAAGATAGGCAGGGCGTGGTGGCTC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/MacFas5.0/TTCATTGACAACATT
lang : en | db : MacFas5.0 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.079 | 0.072 | search_plus_done; http://172.18.8.76:28122/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.087 | 0.008 | search_minus_done; http://172.18.8.76:28122/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=42
0.090 | 0.003 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).