GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2024-07-25 20:57:20, GGGenome : Golden hamster genome, MesAur1.0 (Mar, 2013)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

NW_004801605.1 Mesocricetus auratus isolate Golden Hamster female 1 unplaced genomic scaffold, MesAur1.0 scaffold00002, whole genome shotgun sequence
position: 25927523-25927537
CAACACTGGTAAAATAATCAAAGCTGCCAT25927523TTCATTGACAACATTAAATATGCTTCAAGTAGCAGCCACAGAGTA
NW_004801606.1 Mesocricetus auratus isolate Golden Hamster female 1 unplaced genomic scaffold, MesAur1.0 scaffold00003, whole genome shotgun sequence
position: 14723665-14723679
AGTGCTGGCCACAAGAATTGTTTGGTCTGC14723665TTCATTGACAACATTATAATAAACTGGTATTTAAAGAATATTTTT
NW_004801608.1 Mesocricetus auratus isolate Golden Hamster female 1 unplaced genomic scaffold, MesAur1.0 scaffold00005, whole genome shotgun sequence
position: 25186141-25186155
AGTCATCCCTTGAGCTTTTCTAAACACCAT25186141TTCATTGACAACATTCACCTGAACTGTTTCCTTATGGGGCCCTCA
NW_004801608.1 Mesocricetus auratus isolate Golden Hamster female 1 unplaced genomic scaffold, MesAur1.0 scaffold00005, whole genome shotgun sequence
position: 26082377-26082391
TTTAGTCCTAAGAAAAAAACAAGGAATCTT26082377TTCATTGACAACATTAGTGTACAGAGAAGGTAAGTGAAATGAGCC
NW_004801732.1 Mesocricetus auratus isolate Golden Hamster female 1 unplaced genomic scaffold, MesAur1.0 scaffold00129, whole genome shotgun sequence
position: 4999855-4999869
TTCACTGTGAACAAAAATATGTTGATATTA4999855TTCATTGACAACATTAAATGATATGGGGTGCCAGAAAAATCTCCA
NW_004801771.1 Mesocricetus auratus isolate Golden Hamster female 1 unplaced genomic scaffold, MesAur1.0 scaffold00168, whole genome shotgun sequence
position: 2312373-2312387
TCAGCCTCACCCCACAAACCAAAACCATAT2312373TTCATTGACAACATTTAAATATCTCTGGCTTCTGCCCAGAAACAT
NW_004801909.1 Mesocricetus auratus isolate Golden Hamster female 1 unplaced genomic scaffold, MesAur1.0 scaffold00306, whole genome shotgun sequence
position: 267295-267309
GTGAACAGCCAATACTGGCACCTGTGGGAA267295TTCATTGACAACATTGTGCAGTTTGTGTCCTTTGGACTGTGGGAA
NW_004801606.1 Mesocricetus auratus isolate Golden Hamster female 1 unplaced genomic scaffold, MesAur1.0 scaffold00003, whole genome shotgun sequence
position: 32851751-32851765
TGAGTCTTTCTGTTAATAGTTTAATGTGAA32851751AATGTTGTCAATGAAAATTTGAGAACAAAAAGCCTCTATCTATGG
NW_004801627.1 Mesocricetus auratus isolate Golden Hamster female 1 unplaced genomic scaffold, MesAur1.0 scaffold00024, whole genome shotgun sequence
position: 9364800-9364814
AACAGATGTTCAGTCATGCTGAGTCCTTGA9364800AATGTTGTCAATGAAAAGAATTCTCCATGTGATGTGTGTGCGAGT
NW_004801661.1 Mesocricetus auratus isolate Golden Hamster female 1 unplaced genomic scaffold, MesAur1.0 scaffold00058, whole genome shotgun sequence
position: 4236990-4237004
TAGCTACTAGGCAAGCAATTGGCCATTCCA4236990AATGTTGTCAATGAATCATAAGATGTTTCCCTTTATACTTGATGA
NW_004801701.1 Mesocricetus auratus isolate Golden Hamster female 1 unplaced genomic scaffold, MesAur1.0 scaffold00098, whole genome shotgun sequence
position: 5574992-5575006
ACCATAACCACCAGAAAATAACCCTGAGAC5574992AATGTTGTCAATGAATGCAATGGGAGGCTATTTACTGCAAAGAAA
NW_004801763.1 Mesocricetus auratus isolate Golden Hamster female 1 unplaced genomic scaffold, MesAur1.0 scaffold00160, whole genome shotgun sequence
position: 739855-739869
CAACAATTAAAAAATTTTGTATTACTCAAA739855AATGTTGTCAATGAATTTCCATTCTCTGGATTTTAGTTAAATAAA
NW_004801786.1 Mesocricetus auratus isolate Golden Hamster female 1 unplaced genomic scaffold, MesAur1.0 scaffold00183, whole genome shotgun sequence
position: 383367-383381
ATCCCATAGACCAAAGGACACGAACTGCAC383367AATGTTGTCAATGAATTCCCACAAGTGCCAGTATTGGTGTTCAAA
NW_004801909.1 Mesocricetus auratus isolate Golden Hamster female 1 unplaced genomic scaffold, MesAur1.0 scaffold00306, whole genome shotgun sequence
position: 434594-434608
ATCCCATAGACCAAAGGACACGAACTGCAC434594AATGTTGTCAATGAATTCCCACAAGCGCCAGTATTGGCTGTTCAA
NW_004804955.1 Mesocricetus auratus isolate Golden Hamster female 1 unplaced genomic scaffold, MesAur1.0 scaffold03352, whole genome shotgun sequence
position: 3374-3388
TGTAATATTGTGCTGAGACTCACTGTGACA3374AATGTTGTCAATGAAGTGTTAGTTACGCGTATTTTAGTAATCTAG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/MesAur1.0/TTCATTGACAACATT
lang : en | db : MesAur1.0 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.009 | 0.009 | search_start;
0.083 | 0.074 | search_plus_done; http://172.18.8.77:28240/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.091 | 0.008 | search_minus_done; http://172.18.8.77:28240/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=43
0.096 | 0.005 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).