GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-01 12:11:42, GGGenome : Megaselia scalaris genome, Msca1 (Feb, 2013)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

C192312 dna:scaffold scaffold:Msca1:C192312:1:372:1
position: 240-254
GTCGATATTCCACTGGGCAAAAAAATATAC240TTCATTGACAACATTAAATGGATGGAAATAAATTTCCAAATTTCC
scaffold28928 dna:scaffold scaffold:Msca1:scaffold28928:1:17728:1
position: 10691-10705
CGTGATCAAGAAGGACAAGATGTATTGCTT10691TTCATTGACAACATTTTCCGTTTCACCCAAGCTGGTTCTGAAGTA
C667006 dna:scaffold scaffold:Msca1:C667006:1:1135:1
position: 161-175
AAAAACATGAAAAACTAATTTGCCCGCGAA161AATGTTGTCAATGAAACACACTATAACGTTACTTCGCTTAAATAC
C714828 dna:scaffold scaffold:Msca1:C714828:1:1973:1
position: 1431-1445
ATTGAAGCTCAAAATCGATGCACCTGGATA1431AATGTTGTCAATGAAATGGAATCTGCCAGAAGGTTCGTCGCTAAT
C744174 dna:scaffold scaffold:Msca1:C744174:1:4405:1
position: 501-515
ATGGGTATCACCAGAAGGAGCTCAGTTTGA501AATGTTGTCAATGAAAGGGTTTTTCAATTACTACATCTTGTTGTA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Msca1/TTCATTGACAACATT
lang : en | db : Msca1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.079 | 0.072 | search_plus_done; http://172.18.8.76:28150/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.084 | 0.005 | search_minus_done; http://172.18.8.76:28150/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=48
0.086 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).