GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2022-01-23 21:07:21, GGGenome : Nicotiana benthamiana genome, v1.0.1 (Jul, 2014)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Niben101Scf00052 cov=14.1
position: 442832-442846
ATGGTCCTCTCCACTTCGGGAATACACAAG442832AATGTTGTCAATGAACACTATCACAAAGGAGTCTAGAAAAGTTTG
Niben101Scf00087 cov=13.8
position: 351118-351132
ATGATCCTCCCGGCTATGAGAATACACCAA351118AATGTTGTCAATGAACACGATGAAGAAAAAGTCAAGATATGGTTG
Niben101Scf00293 cov=12.8
position: 319407-319421
TATTCTTAATGTATGAGTTCTGAGCAAGCA319407AATGTTGTCAATGAAAGTAAATGGAACCCGAATAAGTAGGAGTTA
Niben101Scf00393 cov=14.2
position: 56561-56575
ATGGTCCTCTCGACTTGGGGAATACACAAG56561AATGTTGTCAATGAACACTATCACAAAGGAGTTTATTAAAGGCTT
Niben101Scf00457 cov=13.6
position: 761674-761688
ATGCTCCTCCTGACTGCGGGAGTATGTCAG761674AATGTTGTCAATGAATACAATCACGAACAAATCCAAATAGGATTT
Niben101Scf00714 cov=13.3
position: 74987-75001
GTGCTCCCTCAGGCTACGCGAGTATATCAA74987AATGTTGTCAATGAAGACGATTACAAAATAATCAATAAAAGGCCG
Niben101Scf00920 cov=13.7
position: 813649-813663
ATGCTCCTCCTGACTGCGGCAGTATATCAA813649AATGTTGTCAATGAATACAATCACAAATAAGTCCAAATAGGGACT
Niben101Scf01460 cov=14.6
position: 483979-483993
CATAGGCAAGCCAACCTGGGTAAATCTGAA483979AATGTTGTCAATGAAGAGAAGCACATCCTGCCCCTCAGCATCTCT
Niben101Scf01504 cov=12.6
position: 21770-21784
ATGGTCCTCCTAACTGTGGGAGTATATCAA21770AATGTTGTCAATGAATAGAATCACGAAAAAAATCCAAATAGTGCC
Niben101Scf01770 cov=13.2
position: 51081-51095
GGTTATTATAACCATGACTTGTTTGTACTC51081AATGTTGTCAATGAAAATGCTAGTAATTATGCTTATTTGATTATA
Niben101Scf02500 cov=13.0
position: 221316-221330
ATGCTCCTCTTGTCTGTGGGAGTATATCAA221316AATGTTGTCAATGAATACAATCACAAATAAATCCAAATAGGGCTA
Niben101Scf02668 cov=14.2
position: 342958-342972
TATCCTTAATGTATGAGTTCTGAGCATGCA342958AATGTTGTCAATGAAAGCAAATGGAACCTGAATAAGTAGGAGTTT
Niben101Scf03028 cov=13.2
position: 468972-468986
ATGATCCTCCCTGCTCCGCGAATACACGAA468972AATGTTGTCAATGAAAACAATCACGAAGGAGTCTAGACATGGCTT
Niben101Scf03254 cov=13.0
position: 980665-980679
ATGCTCCACCTGGCTACGAGAGTATATCAG980665AATGTTGTCAATGAATACAATCACGAACAAATCAATATAGGGTCT
Niben101Scf03444 cov=13.2
position: 249960-249974
ATGCTCGTCCTGACTGCGGGCGTATATCAA249960AATGTTGTCAATGAAAACAATCATAAAAAAATCCATATAGGGCAT
Niben101Scf04398 cov=12.7
position: 184485-184499
ATGCTCCTCCTGACTGCGGGATTATATCAA184485AATGTTGTCAATGAATACGATCACAAACAAATCTAAAGAGGGCCT
Niben101Scf04401 cov=13.1
position: 313103-313117
ATGCTCCTCCTTATTGCGGGAGTATATCAA313103AATGTTGTCAATGAATACAATCATGAAAAAATAAAGATAGGGCCT
Niben101Scf04781 cov=13.0
position: 31342-31356
ATGCTCCTCCTGGTTGCGAGAGTATATCAG31342AATGTTGTCAATGAATACAATCATGAATAAATCCAAATACGGTCT
Niben101Scf05066 cov=13.5
position: 278321-278335
CCGATCCTCCTGATTGCAGGAGTATATCAG278321AATGTTGTCAATGAAGACAATCACGAACAAATCCAAATAGGGCCT
Niben101Scf05674 cov=12.4
position: 579600-579614
GTGCTCCTCTTGACTGTGGGAGTATATCAA579600AATGTTGTCAATGAATACAATCACAAACAAATCCAAGTAGGGCCT
Niben101Scf05732 cov=13.9
position: 467209-467223
ATGCTCCTCGTGGCTGCGGGAGTATATCAG467209AATGTTGTCAATGAATACAATCACGAACAAATACAAGTAGTGCCT
Niben101Scf06156 cov=12.8
position: 390748-390762
ATGCTCCTCCTAACTGCATAAGTGTATCAA390748AATGTTGTCAATGAATACAGTCACAGTCAAATCCAAATACGTCCT
Niben101Scf07172 cov=13.9
position: 167210-167224
GTGCTCTCCCAGGCTTCGTTAGTATATCAA167210AATGTTGTCAATGAAGATGATGACAAAGGAATCAATATAAGGTGC
Niben101Scf07729 cov=13.4
position: 275090-275104
TTGCTCCTCCTGACTGCGGGAGTATATCAA275090AATGTTGTCAATGAATACAATCACAAACAAATCTAAATAGGGTCT
Niben101Scf07942 cov=12.5
position: 177237-177251
ATGCTCCTCCTGACTGTGGGAGTATATTAA177237AATGTTGTCAATGAATACAATCACAAACAAATACAAATAGCGCCT
Niben101Scf07942 cov=12.5
position: 185412-185426
ATGCTCTTCCTGACTGCCAGGGTATATCAG185412AATGTTGTCAATGAAAACAATCACGAACAAATCCAACTAGGGCCT
Niben101Scf08390 cov=13.2
position: 495401-495415
GAAATACAATTGTGTAGCATCAGTAACTAA495401AATGTTGTCAATGAACTTAATCTTCCCAGCAGAAGGGAGGAGAGG
Niben101Scf08621 cov=14.0
position: 234796-234810
ATGCTCCTTCTGACCGCAGGAGTATATCAA234796AATGTTGTCAATGAATACAATCACAAAGAAATCCAAATGAGGCTG
Niben101Scf09353 cov=13.0
position: 749242-749256
ATGCTCCTCCTGACTCCAGGAGTATATCAG749242AATGTTGTCAATGAATAAAATCACAAAAAATCCAAATAGGTCCTG
Niben101Scf11008 cov=14.1
position: 227007-227021
ATGGTCCTCCTAGCTTCGGGAATATACCAG227007AATGTTGTCAATGAACACTATCACAGAAGAGTCTATAAAGGGCTT
Niben101Scf11475 cov=12.1
position: 1226-1240
TGACGAAATGTTAGATTAGTCTTTTGACAA1226AATGTTGTCAATGAATGTTAGGCCAGATAGGTTTATAATGGTAAG
Niben101Scf12308 cov=15.0
position: 105448-105462
CATAGTCAAGCCAACCTGGGTAAATCTGAA105448AATGTTGTCAATGAAGAGAAGCACATCCTGCCCCTCAGCATCTCT
Niben101Scf34908 cov=11.9
position: 536-550
ACCCAATGAAGCTCTTAAAATTTTCCATGA536AATGTTGTCAATGAATGTTAGGCCAGATGAGTTTATAATGGTAAG
Niben101Ctg13865 cov=16.0
position: 483-497
ATGATCCTCCCGTGTCCAGGAATACACAAG483AATGTTGTCAATGAAAACGCTAATAAAAGAGTCAAGATAGGGCAG
Niben101Scf00146 cov=14.4
position: 27934-27948
AAGCCCTTTCTACACTCTTTTGTGATAGTG27934TTCATTGACAACATTCTGGTATATTCCTGAAGTCGGGAGGACCAT
Niben101Scf00394 cov=12.6
position: 222696-222710
AGACCCTATTTGGATTTGTTTGTGATTGTA222696TTCATTGACAACATTTTGATATACTCCTACATTCAGGAGGAGCAT
Niben101Scf00654 cov=13.7
position: 131482-131496
AGGCCCTATTTGGATCTGTTTGTGATTGTA131482TTCATTGACAACATTTTGATATACTCCCATAGTCAGGAGGAGCAT
Niben101Scf00776 cov=12.3
position: 34264-34278
CCGACCTATCTTGACTCTTTCTTCATCATA34264TTCATTGACAACATTCTGGTGTACTCCCGAACTTGGGAAGATCAT
Niben101Scf00911 cov=13.5
position: 476911-476925
AAGTCATTTTTAGACTCCTTCGTGATTGTT476911TTCATTGACAACATTCTCCTATATTTGCGGAATAGGGAGGATCAT
Niben101Scf01017 cov=13.7
position: 341436-341450
AAGCCTTTTCTTGACTTCTTTGTAATAGTG341436TTCATTGACAACATTCTTGTATATTTTTGAAGCCTAGAGGACCAT
Niben101Scf01198 cov=13.9
position: 365266-365280
CAAGCCTTGCTAGACTCTTTTGTGATAGTT365266TTCATTGACAACATTCTGGTATATTCTCGAAGTCCGAAAGACTAC
Niben101Scf01209 cov=13.4
position: 560104-560118
ATGCCTTATATTGATTCCTTTGTTATCATT560104TTCATTGACAACATTTTGATATACTCACGCAGCCTGGGGGTGAAC
Niben101Scf01292 cov=13.6
position: 361362-361376
AGGCGTTATATTGAATACTGTGTTATCGTT361362TTCATTGACAACATTTTGATATACTCACGTAGCCTAGGGGAGCAC
Niben101Scf01758 cov=13.4
position: 240591-240605
AGGACCTATTTGGATTAGTTTGTGATTGTA240591TTCATTGACAACATTCTGATATACTCCTGCAGTCAGGAGGAGCAT
Niben101Scf01819 cov=13.8
position: 174283-174297
AGGCCCTATCTGGATTGTTTTGTGTTCGTA174283TTCATTGACAACATTTTGATATACTCCCGCAGTCAGGAGGAGCAT
Niben101Scf01942 cov=13.7
position: 789791-789805
AGGCCCTATTTGGATTTGTTTGTGATTGTA789791TTCATTGACAACATTTTGATATACTCTCGCAGTCAGGAGGAGCAT
Niben101Scf01997 cov=13.2
position: 151634-151648
TGACCCTATTTGGATTTGTTCGTAATTGTA151634TTCATTGACAACATTCTGATATACTCTCGCAGTTAGGAGGAGCAT
Niben101Scf01997 cov=13.2
position: 159939-159953
AGACCCTATTTGGATTTGTTCGTAATTGTA159939TTCATTGACAACATTCTGATATACTCCCGCAGTTAGGAGGAGCAT
Niben101Scf02487 cov=12.8
position: 255471-255485
AGGCCTTATTTGGATCTGTTCATGATTGTA255471TTCATTGACAACATTTTAATATACTCCTGCGGTCAGGAGGAGCAT
Niben101Scf02517 cov=13.5
position: 1584678-1584692
AAGCCCTTTCTAGACTCTTTTGTGATAGTG1584678TTCATTGACAACATTCTGGTATATTCCCAAAGTTGGGAGGACAAT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Niben_v1.0.1/AATGTTGTCAATGAA
lang : en | db : Niben_v1.0.1 | k : 0 | strand : | nogap : | query_string : AATGTTGTCAATGAA | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.079 | 0.071 | search_plus_done; http://172.18.8.77:28237/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.102 | 0.023 | search_minus_done; http://172.18.8.77:28237/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=16
0.111 | 0.009 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).