GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-12-01 13:11:09, GGGenome : Nicotiana benthamiana genome, v1.0.1 (Jul, 2014)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Niben101Scf00146 cov=14.4
position: 27934-27948
AAGCCCTTTCTACACTCTTTTGTGATAGTG27934TTCATTGACAACATTCTGGTATATTCCTGAAGTCGGGAGGACCAT
Niben101Scf00394 cov=12.6
position: 222696-222710
AGACCCTATTTGGATTTGTTTGTGATTGTA222696TTCATTGACAACATTTTGATATACTCCTACATTCAGGAGGAGCAT
Niben101Scf00654 cov=13.7
position: 131482-131496
AGGCCCTATTTGGATCTGTTTGTGATTGTA131482TTCATTGACAACATTTTGATATACTCCCATAGTCAGGAGGAGCAT
Niben101Scf00776 cov=12.3
position: 34264-34278
CCGACCTATCTTGACTCTTTCTTCATCATA34264TTCATTGACAACATTCTGGTGTACTCCCGAACTTGGGAAGATCAT
Niben101Scf00911 cov=13.5
position: 476911-476925
AAGTCATTTTTAGACTCCTTCGTGATTGTT476911TTCATTGACAACATTCTCCTATATTTGCGGAATAGGGAGGATCAT
Niben101Scf01017 cov=13.7
position: 341436-341450
AAGCCTTTTCTTGACTTCTTTGTAATAGTG341436TTCATTGACAACATTCTTGTATATTTTTGAAGCCTAGAGGACCAT
Niben101Scf01198 cov=13.9
position: 365266-365280
CAAGCCTTGCTAGACTCTTTTGTGATAGTT365266TTCATTGACAACATTCTGGTATATTCTCGAAGTCCGAAAGACTAC
Niben101Scf01209 cov=13.4
position: 560104-560118
ATGCCTTATATTGATTCCTTTGTTATCATT560104TTCATTGACAACATTTTGATATACTCACGCAGCCTGGGGGTGAAC
Niben101Scf01292 cov=13.6
position: 361362-361376
AGGCGTTATATTGAATACTGTGTTATCGTT361362TTCATTGACAACATTTTGATATACTCACGTAGCCTAGGGGAGCAC
Niben101Scf01758 cov=13.4
position: 240591-240605
AGGACCTATTTGGATTAGTTTGTGATTGTA240591TTCATTGACAACATTCTGATATACTCCTGCAGTCAGGAGGAGCAT
Niben101Scf01819 cov=13.8
position: 174283-174297
AGGCCCTATCTGGATTGTTTTGTGTTCGTA174283TTCATTGACAACATTTTGATATACTCCCGCAGTCAGGAGGAGCAT
Niben101Scf01942 cov=13.7
position: 789791-789805
AGGCCCTATTTGGATTTGTTTGTGATTGTA789791TTCATTGACAACATTTTGATATACTCTCGCAGTCAGGAGGAGCAT
Niben101Scf01997 cov=13.2
position: 151634-151648
TGACCCTATTTGGATTTGTTCGTAATTGTA151634TTCATTGACAACATTCTGATATACTCTCGCAGTTAGGAGGAGCAT
Niben101Scf01997 cov=13.2
position: 159939-159953
AGACCCTATTTGGATTTGTTCGTAATTGTA159939TTCATTGACAACATTCTGATATACTCCCGCAGTTAGGAGGAGCAT
Niben101Scf02487 cov=12.8
position: 255471-255485
AGGCCTTATTTGGATCTGTTCATGATTGTA255471TTCATTGACAACATTTTAATATACTCCTGCGGTCAGGAGGAGCAT
Niben101Scf02517 cov=13.5
position: 1584678-1584692
AAGCCCTTTCTAGACTCTTTTGTGATAGTG1584678TTCATTGACAACATTCTGGTATATTCCCAAAGTTGGGAGGACAAT
Niben101Scf02567 cov=12.6
position: 138134-138148
AGGCCCTATTTGGATTTGTTTGTGATTGTA138134TTCATTGACAACATTCTGATATACTCCCGCAGTCAGGAGGAGCAT
Niben101Scf02720 cov=14.4
position: 787962-787976
AAGCCCTTTCTAAACTACTTTGTGATAGTG787962TTCATTGACAACATTCTAGTATATTCTCGAAGTCGGGAGGGCAAC
Niben101Scf02720 cov=14.4
position: 789983-789997
AAGCCCTTTCTAAACTACTTTGTGATAGTG789983TTCATTGACAACATTCTAGTATATTCTCGAAGTCGGGAGGGCAAC
Niben101Scf03143 cov=13.2
position: 726765-726779
ACTATTGGTACTCTTTTCAAAGGGGTATGC726765TTCATTGACAACATTTTTGATGGCGTAATCGTCGGAGTTGACCTC
Niben101Scf03254 cov=13.0
position: 480816-480830
GGGTCCTATTTGGATTTGTTCATGATTGTA480816TTCATTGACAACATTATGATATACTCCCGCAGCCATGAGGAGCAT
Niben101Scf03295 cov=14.2
position: 636167-636181
TGACTGTTCAGTGATTAGTTTTTGCAAAGC636167TTCATTGACAACATTTTCATTTTAAAATCGAGTATTTGCATTCGA
Niben101Scf03370 cov=13.2
position: 432396-432410
AGGCCCTATTTGGATTTGTTCGTGATTGTA432396TTCATTGACAACATTCTGATATACTCCCGCAATAAAGAGGAGCAT
Niben101Scf03405 cov=12.2
position: 453350-453364
AAGTCATTCTTAGACTCTTTCATGATTGTT453350TTCATTGACAACATTCTTGTATATTCGCAGAGTAGGGAGGATCAT
Niben101Scf03673 cov=13.6
position: 457730-457744
CAGGCCTACATCGATTTGTTCGTGATTGTA457730TTCATTGACAACATTCTGATATACTCCTGCAGTCAGGAAGAGCAT
Niben101Scf03934 cov=13.8
position: 278243-278257
AGGCCCTATTTGGATTTGTTCGTGATTGTA278243TTCATTGACAACATTCTGCTATGCTCCCGCAGTCGGGAAGAGCAT
Niben101Scf04156 cov=13.6
position: 208130-208144
ATGCTCTATTTGGATTTGTTTGTGATTGTA208130TTCATTGACAACATTTTGACATACTCCTGTAGTCAGGAGGAGCAT
Niben101Scf04614 cov=13.6
position: 1009809-1009823
CTTACCATTATAAACTCATCTGGCCTAACA1009809TTCATTGACAACATTTCATGGAAAATTTTGACAGCTTCATTGGGC
Niben101Scf04777 cov=13.7
position: 191274-191288
ATGCCCTATTTGGATTTGTTTGTTATTGTA191274TTCATTGACAACATTTTGATATACTCCCGTAGTCAGGATGAGCAT
Niben101Scf04869 cov=13.6
position: 341216-341230
AGGCCCCATTTGGACTTGTTCATGATTGTA341216TTCATTGACAACATTCTGATATACTCCCGCAGTCAGGAGGAGCAT
Niben101Scf04871 cov=12.9
position: 450430-450444
AGGCTCTATTTTATTTTTCTCATGATTGTA450430TTCATTGACAACATTCTAATATACTCCCACAACTAGGAGGAGCAA
Niben101Scf05372 cov=13.1
position: 295149-295163
AGGCCCTAGTTGGATTTATTTGTGATTGTA295149TTCATTGACAACATTTTGATATACTCCCGGAGACAGGAGGAGCAT
Niben101Scf05915 cov=12.5
position: 149945-149959
CTTACCATTATAAACTCATCTGTCCTAACA149945TTCATTGACAACATTTCATGGAAAATTTTGAGAGCTTCATTGGGC
Niben101Scf06528 cov=12.1
position: 315689-315703
AAGCCCTTCTTAGACTCATTTGTGATAGTG315689TTCATTGACAACATTCTTGTATATTCCCGAAGTCAGGAAGACCAT
Niben101Scf08651 cov=13.1
position: 285459-285473
TGTTGGGCCAACCAAGGAAGAACCTCTTCT285459TTCATTGACAACATTTCTAAATATTGGGTTTTGTCCTCTTCGTTG
Niben101Scf10031 cov=13.1
position: 372939-372953
ATGCCCTATCTAGATTTATTCGTGATTGTA372939TTCATTGACAACATTTTGATATACTCCCACAGTCAAGAGGAGCAT
Niben101Scf10855 cov=13.5
position: 290999-291013
AGCCACTATTTTGATTTGTTTGCGATTGTA290999TTCATTGACAACATTTTGATATACTCTCACAGTCAGGAGGAGCAT
Niben101Scf11620 cov=12.7
position: 73902-73916
AAGCCCTAATTGGATTTGTTTGTGATTGTC73902TTCATTGACAACATTATCATATACTCCCGTAGTCAGGAGGAAAAT
Niben101Scf11936 cov=13.0
position: 66944-66958
AAGTCATTTTTAGACTCCTTCGTGATTGTT66944TTCATTGACAACATTCTCGTACATTCGCAGAGTAGGGAGGATCCT
Niben101Scf12277 cov=12.9
position: 82293-82307
AGACCCTATTTGGATCTGTTTGTGATTGTA82293TTCATTGACAACATTTTGATATACTCCCACTGTTAGAGGAGCATG
Niben101Scf13168 cov=13.0
position: 101102-101116
AAGCCCTCTTTGGATTTTTTTGTGATTGTA101102TTCATTGACAACATTTTGATATACTCCCGCAGTCAAGAGGAGCAT
Niben101Scf14431 cov=11.2
position: 37001-37015
AGTCCCTATTTGGATTTGTTTGTTAATATA37001TTCATTGACAACATTTTGATATACTCCTGCAATCCGGAGGAGCAT
Niben101Scf24272 cov=15.4
position: 14668-14682
CTTACCATTATAAACTCATCTGGCCTAACA14668TTCATTGACAACATTTCATGGAAAATTTTAAGAGCTTCATTGGGT
Niben101Scf34538 cov=13.1
position: 7664-7678
AGGCCCTATCTAGATTTGCTCGTGATTATA7664TTCATTGACAACATTTTGATATACTCCCGCAGTCAGGAGGAGTAT
Niben101Scf00052 cov=14.1
position: 442832-442846
ATGGTCCTCTCCACTTCGGGAATACACAAG442832AATGTTGTCAATGAACACTATCACAAAGGAGTCTAGAAAAGTTTG
Niben101Scf00087 cov=13.8
position: 351118-351132
ATGATCCTCCCGGCTATGAGAATACACCAA351118AATGTTGTCAATGAACACGATGAAGAAAAAGTCAAGATATGGTTG
Niben101Scf00293 cov=12.8
position: 319407-319421
TATTCTTAATGTATGAGTTCTGAGCAAGCA319407AATGTTGTCAATGAAAGTAAATGGAACCCGAATAAGTAGGAGTTA
Niben101Scf00393 cov=14.2
position: 56561-56575
ATGGTCCTCTCGACTTGGGGAATACACAAG56561AATGTTGTCAATGAACACTATCACAAAGGAGTTTATTAAAGGCTT
Niben101Scf00457 cov=13.6
position: 761674-761688
ATGCTCCTCCTGACTGCGGGAGTATGTCAG761674AATGTTGTCAATGAATACAATCACGAACAAATCCAAATAGGATTT
Niben101Scf00714 cov=13.3
position: 74987-75001
GTGCTCCCTCAGGCTACGCGAGTATATCAA74987AATGTTGTCAATGAAGACGATTACAAAATAATCAATAAAAGGCCG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Niben_v1.0.1/TTCATTGACAACATT
lang : en | db : Niben_v1.0.1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.084 | 0.076 | search_plus_done; http://172.18.8.77:28237/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.115 | 0.030 | search_minus_done; http://172.18.8.77:28237/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=6
0.118 | 0.004 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).