GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-02-28 13:27:22, GGGenome : Nasonia vitripennis genome, Nvit_2.1 (Nov, 2012)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

1 dna:chromosome chromosome:GCA_000002325.2:1:1:33571687:1
position: 9771918-9771932
AGAATAATTTTACTGATATTTTACTCGGTT9771918TTCATTGACAACATTTCTGTCTGAGTAAGTAAAATCATTAAAAAT
GL341022 dna:supercontig supercontig:GCA_000002325.2:GL341022:1:4040552:1
position: 763082-763096
GACCTCAGAACCAGCCTGGGTGAATCTGAA763082AATGTTGTCAATGAAGAGCAACACATCCTGACCCTCCTGATCACG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Nvit_2.1/TTCATTGACAACATT
lang : en | db : Nvit_2.1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.123 | 0.116 | search_plus_done; http://172.18.8.76:28153/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.132 | 0.009 | search_minus_done; http://172.18.8.76:28153/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=49
0.132 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).