GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-04 11:33:37, GGGenome : Oryza brachyantha genome, Oryza_brachyantha.v1.4b (May, 2011)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

1 dna:chromosome chromosome:Oryza_brachyantha.v1.4b:1:1:33916305:1
position: 33490991-33491005
AGATGGAAAAAACCATTAGTATCAGATTAC33490991TTCATTGACAACATTGACATGTTGAAGTACGCTGAAAGATGGCAT
7 dna:chromosome chromosome:Oryza_brachyantha.v1.4b:7:1:18603524:1
position: 14519962-14519976
AGATCTATCTAATTTAGATATAGCGCTCTC14519962TTCATTGACAACATTTTTCACTTCCTGCATTAGATTTCCATTATC
7 dna:chromosome chromosome:Oryza_brachyantha.v1.4b:7:1:18603524:1
position: 18426000-18426014
GCTTGAAGAACTGTGGAAAGAAATGGATTA18426000TTCATTGACAACATTAGCACTTCTCGAGAAAAAGCAGGTATGGTG
4 dna:chromosome chromosome:Oryza_brachyantha.v1.4b:4:1:21479432:1
position: 19667937-19667951
GATCCTGTGGACCCTGCAAAAGATGTCGAG19667937AATGTTGTCAATGAAGGCAATGCTGCATCCAAAGTTCATATAGGT
5 dna:chromosome chromosome:Oryza_brachyantha.v1.4b:5:1:20131956:1
position: 5552582-5552596
TATGATTGAGCACTCCTACCTACTTTGCAA5552582AATGTTGTCAATGAACTGTTTGTTCGTCTACATAAATGTTCAATG
5 dna:chromosome chromosome:Oryza_brachyantha.v1.4b:5:1:20131956:1
position: 18148510-18148524
TCATGACCAAATTACCTGAGTGAAACGGAA18148510AATGTTGTCAATGAACAGAAGCACATCTTGTCCTTCAGCATCACG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Orybr_v1.4b/TTCATTGACAACATT
lang : en | db : Orybr_v1.4b | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.078 | 0.072 | search_plus_done; http://172.18.8.75:28182/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.084 | 0.005 | search_minus_done; http://172.18.8.75:28182/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=47
0.085 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).