GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2022-12-08 12:46:31, GGGenome : Oryza glumaepatula genome, ALNU02000000 (Aug, 2013)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

3 dna:chromosome chromosome:ALNU02000000:3:1:37594838:1
position: 9818819-9818833
TGATCCCAATAGTTGTTTATTTTTGGACTC9818819TTCATTGACAACATTGCCACTTTGATGACTGTTCTGACATGAATG
3 dna:chromosome chromosome:ALNU02000000:3:1:37594838:1
position: 25905913-25905927
TACATGTGCACTTTGCAGCTGCCTAAAACA25905913TTCATTGACAACATTGATAGGGAAAAGAGGCATTGCTTATGGAGG
7 dna:chromosome chromosome:ALNU02000000:7:1:28350858:1
position: 11925477-11925491
CGTGTGCCTCCTGGATGCACCAATCGGCTG11925477TTCATTGACAACATTTTGTTGAAGGACCTTGGCAACATCTTTTTG
7 dna:chromosome chromosome:ALNU02000000:7:1:28350858:1
position: 23192142-23192156
AGATCTATCTAATTTAGGTGTAGTGCTCTC23192142TTCATTGACAACATTTTTCACTTCCTGCGTTAGGTTTCCATTATC
9 dna:chromosome chromosome:ALNU02000000:9:1:23490084:1
position: 16020923-16020937
CTTTCAAATGATGGTCAAACTAATTATAAA16020923TTCATTGACAACATTAACTAAACGAGTGAAGAGTGAAGAGAAGAT
10 dna:chromosome chromosome:ALNU02000000:10:1:22967634:1
position: 2572866-2572880
ACAAATATATTCACAATATTGATTCATAGG2572866TTCATTGACAACATTGAGTCACATACTCATTCACAACATCACAGA
2 dna:chromosome chromosome:ALNU02000000:2:1:38039368:1
position: 32437973-32437987
GAGCAAGCCATGAATCGGTACAAACAAGAG32437973AATGTTGTCAATGAACAGGTCTTATCCACACGTCGGACATCAGGA
5 dna:chromosome chromosome:ALNU02000000:5:1:30429317:1
position: 8278751-8278765
TATGATTGAGCACCCCTACCTACTTTGCAA8278751AATGTTGTCAATGAACTGTTTGTTCGCTACATAAACGTTCAATGA
5 dna:chromosome chromosome:ALNU02000000:5:1:30429317:1
position: 28081757-28081771
TCTTGCATAAATTACCTGAGTGAAACGGAA28081757AATGTTGTCAATGAACAAAAGCACATCTTGTCCTTCGGCATCACG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Orygl/TTCATTGACAACATT
lang : en | db : Orygl | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.078 | 0.070 | search_plus_done; http://172.18.8.75:28184/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.086 | 0.007 | search_minus_done; http://172.18.8.75:28184/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=44
0.087 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).