GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-11-29 11:30:03, GGGenome : Oryza meridionalis genome, Oryza_meridionalis_v1.3 (Oct, 2014)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

7 dna:chromosome chromosome:Oryza_meridionalis_v1.3:7:1:26849004:1
position: 20956664-20956678
AGATCTATCTAATTTAGGTGTAGTGCTCTC20956664TTCATTGACAACATTTTTCACTTCCTGCGTTAGGTTTCCATTATC
9 dna:chromosome chromosome:Oryza_meridionalis_v1.3:9:1:18641908:1
position: 13109302-13109316
CTTTCAAATGATGGTCAAACTAATTATAAA13109302TTCATTGACAACATTAACTAAACGAGTGAAGAGTGAAAAGATGAG
5 dna:chromosome chromosome:Oryza_meridionalis_v1.3:5:1:26596109:1
position: 25059153-25059167
TCTTGCATAAATTACCTGAGTGAAACGGAA25059153AATGTTGTCAATGAACAAAAGCACATCTTGTCCTTCGGCATCACG
10 dna:chromosome chromosome:Oryza_meridionalis_v1.3:10:1:17741381:1
position: 2674026-2674040
CATGGTTTTGAACATAGCCACCCTGTAAGA2674026AATGTTGTCAATGAAAATGATACTCGAGGGAATACAACACTAAAT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Oryme_v1.3/TTCATTGACAACATT
lang : en | db : Oryme_v1.3 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.080 | 0.073 | search_plus_done; http://172.18.8.75:28186/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.085 | 0.004 | search_minus_done; http://172.18.8.75:28186/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=48
0.086 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).