GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-04-17 18:30:50, GGGenome : Oryza nivara genome, AWHD00000000 (Aug, 2013)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

5 dna:chromosome chromosome:AWHD00000000:5:1:28014461:1
position: 7684826-7684840
TATGATTGAGCACCCCTACCTACTTTGCAA7684826AATGTTGTCAATGAACTGTTTGTTCGCTACATAAATGTTCAATGA
5 dna:chromosome chromosome:AWHD00000000:5:1:28014461:1
position: 25222964-25222978
TCTTGCATAAATTACCTGAGTGAAACGGAA25222964AATGTTGTCAATGAACAAAAGCACATCTTGTCCTTCGGCATCACG
10 dna:chromosome chromosome:AWHD00000000:10:1:21549876:1
position: 3857723-3857737
CCTCCATAAGCAATGCCTCTTTTCCCTATC3857723AATGTTGTCAATGAATGTTTTAGGCAGCTGCAAAGTGCACATGTA
3 dna:chromosome chromosome:AWHD00000000:3:1:36134596:1
position: 10246666-10246680
TGATCCCAATAGTTGTTTATTTTTGGACTC10246666TTCATTGACAACATTGCCACTTTGATGACTGTTCTGACATGAATG
6 dna:chromosome chromosome:AWHD00000000:6:1:29411429:1
position: 3359431-3359445
TCCTGATGTCCGACGTGTGGATAAGACCTG3359431TTCATTGACAACATTCTCTTGTTTGTACCGATTCATGGCTTGCTC
7 dna:chromosome chromosome:AWHD00000000:7:1:24717764:1
position: 9221547-9221561
CGTGTGCCTCCTGGATGCACCAATCGGCTG9221547TTCATTGACAACATTTTGTTGAAGGACCTTGGCAACATCTTTTTG
7 dna:chromosome chromosome:AWHD00000000:7:1:24717764:1
position: 18603273-18603287
AGATCTATCTAATTTAGGTGTAGTGCTCTC18603273TTCATTGACAACATTTTTCACTTCCTGCGTTAGGTTTCCATTATC
9 dna:chromosome chromosome:AWHD00000000:9:1:20407407:1
position: 13516691-13516705
CTTTCAAATGATGGTCAAACTAATTATAAA13516691TTCATTGACAACATTAACTAAACGAGTGAAGAGTGAAGAGAAGAT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Oryni/AATGTTGTCAATGAA
lang : en | db : Oryni | k : 0 | strand : | nogap : | query_string : AATGTTGTCAATGAA | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.077 | 0.070 | search_plus_done; http://172.18.8.75:28187/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.082 | 0.005 | search_minus_done; http://172.18.8.75:28187/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=47
0.085 | 0.003 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).