GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-02-28 12:42:31, GGGenome : Oryza punctata genome, AVCL00000000 (Aug, 2013)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

3 dna:chromosome chromosome:AVCL00000000:3:1:38925377:1
position: 10657977-10657991
TGATCCCAATAGTTGTTTATTTTTGGACTC10657977TTCATTGACAACATTGCCATTTTGATGACTGTTCTGACATGAATG
9 dna:chromosome chromosome:AVCL00000000:9:1:26294017:1
position: 19098968-19098982
CTTTCAAATGATGGTCAAACTAATTATAAC19098968TTCATTGACAACATTAACTAAACGAGTGACGAGTGAAGAGTGAAG
1 dna:chromosome chromosome:AVCL00000000:1:1:46096743:1
position: 20076390-20076404
TCTACAAAACCTTTATTTAATAGTCCTAAA20076390AATGTTGTCAATGAAATAGAAACTACCTCAACATTCCTGAGGCTG
1 dna:chromosome chromosome:AVCL00000000:1:1:46096743:1
position: 23639178-23639192
ATGCTCCTTTTCATTCTTGGAGTAGATGAG23639178AATGTTGTCAATGAAAACAAAAACAAACTTATCCAAATATTCCAT
2 dna:chromosome chromosome:AVCL00000000:2:1:39559433:1
position: 32637391-32637405
TTTCCTACAATTACATAGATGCCACTAAGA32637391AATGTTGTCAATGAATAGCCATATGGCATGTACAAACTTACCTGA
5 dna:chromosome chromosome:AVCL00000000:5:1:31082981:1
position: 9172512-9172526
TATGATTGAGCACCCCTACCTACTTTGCAA9172512AATGTTGTCAATGAACTGTTTGTTCGCTACATAAATGTTCAATGA
5 dna:chromosome chromosome:AVCL00000000:5:1:31082981:1
position: 28601282-28601296
TCCTGCATAAATTACCTGGGTAAAACGGAA28601282AATGTTGTCAATGAACAGAAGCACATCTTGTCCTTCAGCATCACG
11 dna:chromosome chromosome:AVCL00000000:11:1:28494620:1
position: 5718250-5718264
GCTAGTATAAGAAAATAAATCAACTGGTTA5718250AATGTTGTCAATGAAATATAACTTATACGTTGTGAAAAAAATCGA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Orypu/TTCATTGACAACATT
lang : en | db : Orypu | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.082 | 0.075 | search_plus_done; http://172.18.8.75:28188/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.094 | 0.012 | search_minus_done; http://172.18.8.75:28188/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=48
0.097 | 0.003 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).