GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-04-20 10:42:57, GGGenome : Cucumis sativus (PI 183967) genome

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Chr3
position: 26775467-26775481
ATGCATTTAATTAACCTTCAATTAAATTAA26775467AATGTTGTCAATGAATTTTCAAGTTTGTTTTTATTTAGTCCTTAT
Chr5
position: 21030616-21030630
TTTTGGCATATTTACCTGGGTAAAGCGGAA21030616AATGTTGTCAATGAAGAGAAGCACATCCTGTCCTTCAGCATCACG
Chr6
position: 1681241-1681255
GAATGTTGTGAAATGTTGTTATTGGGGTGG1681241AATGTTGTCAATGAAAAAAAAAATCCACTCCCTCCTCATTCTCGC
Chr1
position: 17753147-17753161
AGTTCTATTCTTTTCAATAGCATTTATTTC17753147TTCATTGACAACATTCTTCCATCCAGGACACTCTAAAGTAGTGTA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/PI183967/AATGTTGTCAATGAA
lang : en | db : PI183967 | k : 0 | strand : | nogap : | query_string : AATGTTGTCAATGAA | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.127 | 0.120 | search_plus_done; http://172.18.8.72:28278/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.132 | 0.004 | search_minus_done; http://172.18.8.72:28278/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=47
0.132 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).