GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-04 10:47:52, GGGenome : Oryza rufipogon genome, PRJEB4137 (Aug, 2013)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

3 dna:chromosome chromosome:PRJEB4137:3:1:34446443:1
position: 9359499-9359513
TGATCCCAATAGTTGTTTATTTTTGGACTC9359499TTCATTGACAACATTGCCACTTTGATGACTGTTCTGACATGAATG
7 dna:chromosome chromosome:PRJEB4137:7:1:26200591:1
position: 11109823-11109837
CCTGTGCCTCCTGGATGCACCAATCGGCTG11109823TTCATTGACAACATTTTGTTGAAGGACCTTGGCAACATCTTTTTG
7 dna:chromosome chromosome:PRJEB4137:7:1:26200591:1
position: 21123081-21123095
AGATCTATCTAATTTAGGTGTAGTGCTCTC21123081TTCATTGACAACATTTTTCACTTCCTGCGTTAGGTTTCCATTATC
9 dna:chromosome chromosome:PRJEB4137:9:1:20482102:1
position: 13892475-13892489
CTTTCAAATGATGGTCAAACTAATTATAAA13892475TTCATTGACAACATTAACTAAACGAGTGAAGAGTGAAGAGAAGAT
10 dna:chromosome chromosome:PRJEB4137:10:1:20731201:1
position: 2103667-2103681
ACAAATATATTCACAATATTGATTCACAGG2103667TTCATTGACAACATTGAGTCACATACTCATTCACAATATTGATTC
2 dna:chromosome chromosome:PRJEB4137:2:1:33962743:1
position: 29098844-29098858
GAGCAAGCCATGAATCGGTACAAACAAGAG29098844AATGTTGTCAATGAACAGGTCTTATCCACACGTCGGACATCAGGA
5 dna:chromosome chromosome:PRJEB4137:5:1:26652778:1
position: 7281431-7281445
TATGATTGAGCACCCCTACCTACTTTGCAA7281431AATGTTGTCAATGAACTGTTTGTTCGCTACATAAATGTTCAATGA
5 dna:chromosome chromosome:PRJEB4137:5:1:26652778:1
position: 24247915-24247929
TCTTGCATAAATTACCTGAGTGAAACGGAA24247915AATGTTGTCAATGAACAAAAGCACATCTTGTCCTTCGGCATCACG
10 dna:chromosome chromosome:PRJEB4137:10:1:20731201:1
position: 4212353-4212367
CCTCCATAAGCAATGCCTCTTTTCCCTATC4212353AATGTTGTCAATGAATGTTTTAGGCAGCTGCAAAGTTGTCACACC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/PRJEB4137/TTCATTGACAACATT
lang : en | db : PRJEB4137 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.078 | 0.071 | search_plus_done; http://172.18.8.75:28189/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.085 | 0.007 | search_minus_done; http://172.18.8.75:28189/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=45
0.087 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).