GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-04 11:36:07, GGGenome : Chinese softshell turtle genome, PelSin_1.0 (Oct, 2011)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

JH212625.1 dna:scaffold scaffold:PelSin_1.0:JH212625.1:1:8938540:1 REF
position: 8281780-8281794
AGTACCTCTTGAGCCAGAATTGCTTGGAAT8281780TTCATTGACAACATTATCCCTTAAAAGAATCATTGCTTGGTACAG
JH207332.1 dna:scaffold scaffold:PelSin_1.0:JH207332.1:1:8114208:1 REF
position: 6208164-6208178
AGCTTCTAAAAAGCCAGGTATTCTTAGCAC6208164TTCATTGACAACATTGCTCTACCTCGCAGGCAGAAGTACCTGGAT
JH212837.1 dna:scaffold scaffold:PelSin_1.0:JH212837.1:1:4836047:1 REF
position: 1824433-1824447
TTTTGGAAAATAAAATCAAAATGTACATGC1824433TTCATTGACAACATTGCTCTGGGATGGGGATGAGGGGTTCTGTAT
JH211635.1 dna:scaffold scaffold:PelSin_1.0:JH211635.1:1:3728198:1 REF
position: 1717635-1717649
TGCACATTGATCGTTATGTGCAGAGAGGAA1717635TTCATTGACAACATTTTTTAAAGCTATGGGAAACTCCTTTTAAAT
JH210658.1 dna:scaffold scaffold:PelSin_1.0:JH210658.1:1:2798019:1 REF
position: 2381311-2381325
AGGCCTAAATACTGTTAAAGTAAATTCCAC2381311TTCATTGACAACATTTAGATTCCAGCCATGCAAACTGATGTCAGT
JH212163.1 dna:scaffold scaffold:PelSin_1.0:JH212163.1:1:2719555:1 REF
position: 1513728-1513742
TGTTTTGAAAGATAAGATCTGTGTGGAATT1513728TTCATTGACAACATTCTTGCAGATCTATAGGAGGGAAGTGTTCCT
JH212176.1 dna:scaffold scaffold:PelSin_1.0:JH212176.1:1:8916547:1 REF
position: 7773783-7773797
TCTCTTAATCTGCTGGTTAACATAATAGAG7773783AATGTTGTCAATGAAACATTTCTGTCCTAGCTACAGCTCATTCTA
JH205555.1 dna:scaffold scaffold:PelSin_1.0:JH205555.1:1:4501651:1 REF
position: 4351232-4351246
CCACTTCCATCAGTGGCCCTGTGAGTGAGC4351232AATGTTGTCAATGAAAGTGTTGAGGAATTCTTTGGTAATATCACT
JH212505.1 dna:scaffold scaffold:PelSin_1.0:JH212505.1:1:4427373:1 REF
position: 1565227-1565241
AAGGAAAGAGGAGGAGAAAAATGGAGAAAA1565227AATGTTGTCAATGAATGTGTCTATGCTAAATGAGGCTAGGAGTGG
JH212414.1 dna:scaffold scaffold:PelSin_1.0:JH212414.1:1:3797177:1 REF
position: 1209500-1209514
TGACCCTGTACAATTTCCACTTCAGTATCC1209500AATGTTGTCAATGAAATTATGGGTACGGAGCACTTTTCAGAATTA
JH206391.1 dna:scaffold scaffold:PelSin_1.0:JH206391.1:1:3357902:1 REF
position: 2031883-2031897
TGATAATTGACAATGAATTGATGCAGATCA2031883AATGTTGTCAATGAAGGCAGATGATTTCCTGTACTGTCTGGGAGG
JH206391.1 dna:scaffold scaffold:PelSin_1.0:JH206391.1:1:3357902:1 REF
position: 2036520-2036534
TGATAATTGACAATGAATTGATGCAGATCA2036520AATGTTGTCAATGAAGGCAGATGATTTCCTGTACTGTCTGGGAGG
JH212624.1 dna:scaffold scaffold:PelSin_1.0:JH212624.1:1:3048330:1 REF
position: 1174870-1174884
AAACACTGAAAATTTGGAAACTCCCAGCTA1174870AATGTTGTCAATGAAGAATCACTCTCTTTAACCCACATTTAGATT
JH208675.1 dna:scaffold scaffold:PelSin_1.0:JH208675.1:1:3046714:1 REF
position: 5156-5170
AATATGATGTCACCTACCTTGTCATTTTAA5156AATGTTGTCAATGAAGAGGTATATGGTAAAAATTACATCCATTTT
JH212626.1 dna:scaffold scaffold:PelSin_1.0:JH212626.1:1:1782165:1 REF
position: 1549824-1549838
TACTTGTTAATCCCTAGCTACTGCAGTATG1549824AATGTTGTCAATGAAGCATGTCACCATCTTGATTATGAAAGGCCG
JH207550.1 dna:scaffold scaffold:PelSin_1.0:JH207550.1:1:95180:1 REF
position: 85375-85389
GGACCAGCCTGGTGGGGAAATGATGGTAAA85375AATGTTGTCAATGAACAGCTGGACGTGGCTATTATGCGGAGCTCC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/PelSin_1.0/TTCATTGACAACATT
lang : en | db : PelSin_1.0 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.079 | 0.072 | search_plus_done; http://172.18.8.76:28121/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.086 | 0.007 | search_minus_done; http://172.18.8.76:28121/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=44
0.091 | 0.005 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).