GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-01 11:34:05, GGGenome : Sperm whale genome, PhyMac_2.0.2 (Sep, 2013)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

scaffold:PhyMac_2.0.2:KI411350.1:1:789321:1 scaffold KI411350.1
position: 257441-257455
AGTATGCTGCACTCCAAATACTATTGTGTT257441TTCATTGACAACATTCACTATTACATATGCATGTGAAAAACAGGC
scaffold:PhyMac_2.0.2:KI404060.1:1:308853:1 scaffold KI404060.1
position: 176793-176807
CAAGCAGATTTGCATTGGTTTCTAAGAGAT176793TTCATTGACAACATTTTTTTATTTGAAGCTTTCCAATTTATATAA
scaffold:PhyMac_2.0.2:KI403042.1:1:454649:1 scaffold KI403042.1
position: 382488-382502
GCTCTTTTGTTGTCTACCAAGTTTATTACT382488TTCATTGACAACATTGCTAGGTATGGACTTTATCTGCTCCAAATC
scaffold:PhyMac_2.0.2:KI403681.1:1:358755:1 scaffold KI403681.1
position: 118539-118553
CTAGAATATATTATCGCTTAAACACAGATT118539TTCATTGACAACATTCTGTGGGCATTCATTTAATATTAATATCAA
scaffold:PhyMac_2.0.2:KI411185.1:1:944390:1 scaffold KI411185.1
position: 671433-671447
GTAGAGCGTGAAAAACTTCCTGGCCAAAAC671433AATGTTGTCAATGAAGCCGCAACTAGCCAACTTCACCCTGATGAT
scaffold:PhyMac_2.0.2:KI404086.1:1:313055:1 scaffold KI404086.1
position: 217539-217553
CTCTGGGGTCAAGAGAAGTTGGAAATCTTA217539AATGTTGTCAATGAATTAGATAAAACAACAACCACGGTAACATCA
scaffold:PhyMac_2.0.2:KI404258.1:1:301937:1 scaffold KI404258.1
position: 187243-187257
GAGATCAGTGCAAAAATATGAGCATTTAAA187243AATGTTGTCAATGAATATCTTAGAATATTATAAGATACATTATTG
scaffold:PhyMac_2.0.2:KI405066.1:1:228092:1 scaffold KI405066.1
position: 194816-194830
CAGCTATTATCAAAAAGACAAGAAATAACA194816AATGTTGTCAATGAAGTGGAGAAAAGAAAACCTTTGTGAACTGTT
scaffold:PhyMac_2.0.2:KI406017.1:1:164874:1 scaffold KI406017.1
position: 12777-12791
CATTCTGAAATGAATGTTGTTGTTGTCATG12777AATGTTGTCAATGAATGAAGTAGTTGTCACGGGGTGCCAGGGGTT
scaffold:PhyMac_2.0.2:KI406346.1:1:151273:1 scaffold KI406346.1
position: 28046-28060
GAACAGTGGAAACGAGCTATGGATTATTTA28046AATGTTGTCAATGAACTCAACTACATGACTCAGATTGTTATCATG
scaffold:PhyMac_2.0.2:KI407122.1:1:117304:1 scaffold KI407122.1
position: 91519-91533
GGTGTGTGGAGGGAATGTGAGAGATTTTTC91519AATGTTGTCAATGAATGTGTGGAGTCCATTGTTTAAAAAATACAA
scaffold:PhyMac_2.0.2:KI402318.1:1:679862:1 scaffold KI402318.1
position: 496317-496331
TTAAAATTTAAAAGAATGTATAATTTCCAA496317AATGTTGTCAATGAATATAAAATAAACTTCCATAGTCATAAGAAG
scaffold:PhyMac_2.0.2:KI402405.1:1:631206:1 scaffold KI402405.1
position: 157176-157190
CCAGGAATAAAGTTGGATTTGAGGGATCTC157176AATGTTGTCAATGAACAGAGGGCATAAGAAAATCAGTATGAAGTA
scaffold:PhyMac_2.0.2:KI402595.1:1:562564:1 scaffold KI402595.1
position: 484899-484913
ATCCATTAGATTTATTGTGGTATCCTAAAT484899AATGTTGTCAATGAAGAGTTTGAGCCTACATTCATCCCTTTACTT
scaffold:PhyMac_2.0.2:KI402960.1:1:482977:1 scaffold KI402960.1
position: 350800-350814
CAGGATAAAGTTGAAATTTAGTAAATATTG350800AATGTTGTCAATGAAGTGATTTCCTTAAACTCTGACCTTTGTTTC
scaffold:PhyMac_2.0.2:KI403165.1:1:436451:1 scaffold KI403165.1
position: 53073-53087
TCCCACTTAGCCCTATCTAGGCAAAGGAGT53073AATGTTGTCAATGAATTAATTTTAATTTGGTTACAAATTAAAGAG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/PhyMac_2.0.2/TTCATTGACAACATT
lang : en | db : PhyMac_2.0.2 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.088 | 0.081 | search_plus_done; http://172.18.8.76:28128/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.102 | 0.014 | search_minus_done; http://172.18.8.76:28128/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=46
0.108 | 0.006 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).