GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-12-01 12:42:02, GGGenome : Populus trichocarpa genome, JGI2.0 (Jan, 2010)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

1 dna:chromosome chromosome:JGI2.0:1:1:48367220:1
position: 32918805-32918819
TTTTCAAGCACATCAGCACAAAAACATAGT32918805TTCATTGACAACATTATGAAATTTAGCATCCGTTTCTGCCAAGAG
2 dna:chromosome chromosome:JGI2.0:2:1:23562801:1
position: 397256-397270
AAATGGGATGAAAAGATGGAAGAAGCTGCA397256TTCATTGACAACATTGGCTGCTACAGGCGTTATACGTTTGATAGT
3 dna:chromosome chromosome:JGI2.0:3:1:20216605:1
position: 719626-719640
CCCTCCTTGATCATTCTTTGGCCTCTTCAA719626TTCATTGACAACATTTTTCAACCTATCTCTTTCTTCAGTAACCAT
8 dna:chromosome chromosome:JGI2.0:8:1:18835763:1
position: 8132720-8132734
CGTGATGCTGAAGGGCAAGATGTGCTTCTC8132720TTCATTGACAACATTTTCCGCTTTACCCAGGTAAAATTCAATGCC
8 dna:chromosome chromosome:JGI2.0:8:1:18835763:1
position: 3043264-3043278
ACTGATTAGCTGCTGAACTTTTGGCTTCTC3043264AATGTTGTCAATGAATCGTCTAGATAATGGTTCGCAAACTGGGAG
10 dna:chromosome chromosome:JGI2.0:10:1:21538349:1
position: 12675168-12675182
GGCATCCAATTTTACCTGGGTAAAGCGGAA12675168AATGTTGTCAATGAATAGAAGCACATCTTGCCCTTCAGCATCACG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Poptr_JGI2.0/TTCATTGACAACATT
lang : en | db : Poptr_JGI2.0 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.079 | 0.071 | search_plus_done; http://172.18.8.75:28193/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.085 | 0.006 | search_minus_done; http://172.18.8.75:28193/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=46
0.086 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).