GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-12-01 12:27:24, GGGenome : Physcomitrella patens genome, v3.0 (Oct, 2007)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Chr01:7007265-7007279
TTGTAAATGTAGCAAAGGTGATGGAGGCTT7007265TTCATTGACAACATTCATCAAAATCAAGATAAAAACTTTCTTTAT
Chr01:19364215-19364229
TTATAAATGCAGCAAAGAGAATTGAGATTT19364215TTCATTGACAACATTCATTAAAATTAAGATGAAAAATAAAAAATC
Chr06:15493709-15493723
TTACAACTATAGTTAAGAGAGTTGAGGCTT15493709TTCATTGACAACATTTATGAAAATCAAGATAAAAAATAAATAAAA
Chr07:1939930-1939944
TAGCAAATGCAATAAAAAAAGTTGATGCTA1939930TTCATTGACAACATTCATCTAAATCAAGATGAAGGATAATAAATC
Chr10:126907-126921
TTTCAAATGTAGCAAAGAAAGTAGAAGCTT126907TTCATTGACAACATTCATCAAAATCAAGTTGAAGACCTTTTTTTA
Chr10:14262459-14262473
TAATGAGATACGTGTATAAGACGCGCAGAT14262459TTCATTGACAACATTATACTCATCTAAGGCATGGAGAGAGACAAA
Chr14:3635788-3635802
CTATAAATGCAACAAAGAAGATTGAGGCTT3635788TTCATTGACAACATTTATCAAAATCAAAATAAAGAATAACAAGAT
Chr14:10030828-10030842
TTACTAATGTAACAAAGATTATTGATGATT10030828TTCATTGACAACATTTATCAAAATGAAGATGAAGAATAAAAATTC
Chr14:10271951-10271965
TCTATCACAAGTAAAAAAATAGCTAAGTTT10271951TTCATTGACAACATTTATCACTATTATAAATTAGCAGGGATATAA
Chr16:8758313-8758327
TTACTAATGCAACAAAGAAGGTTGAAGTTT8758313TTCATTGACAACATTGATCAAAACCAAAATAAAAAATAACAAATC
Chr16:14830473-14830487
TCTTATAAACAACAAAGAAGGTCAATGCTT14830473TTCATTGACAACATTTATTTAAAAGATATGAAGATCTTAGTTATA
Chr23:9715197-9715211
TTGCAAATACAGTAAAGAGAGTTGAAGCTT9715197TTCATTGACAACATTCATCAAAATCAAGATAAAGAATAGCAAATC
Chr24:6232060-6232074
TTACAAATGCAGCAAAGGCGATGGAGGCTT6232060TTCATTGACAACATTCATCAAAATCAAGATGAAAACCTTCTTTAT
Chr25:2782940-2782954
TTATAAATAGGTTTTAGCTTGTTTTTACTT2782940TTCATTGACAACATTCATCAAAATTAAGGACCAATTATTGACAAC
Chr27:2590568-2590582
TTATAAATGTAGCAAAGAAGATAGAGGCCT2590568TTCATTGACAACATTTATTAAAATCTAGATGAAGAATAGAAAATC
Chr01:4100609-4100623
TTAATGATCACTAAATAAAATGTTACTATT4100609AATGTTGTCAATGAATGAATATTATTAATGTTGTATAGATAAGTT
Chr02:7714252-7714266
ATCTTATTATTTTTTATCTTGATTTTATTG7714252AATGTTGTCAATGAAAAATCTCAATCTCTTTTGCTACATTTGCAA
Chr03:3286912-3286926
AGATTTACTATTTGTTAGATGGTTTTAATA3286912AATGTTGTCAATGAAAAACCTCCACTCTCTTTGATGTATTTGCAA
Chr03:15390405-15390419
GTTGCAATTACATTAAAAAACAATGGATAC15390405AATGTTGTCAATGAAACCAACAAATAAGGCCACCACCAAATAAAC
Chr03:17397579-17397593
GATTTGTTATCTTTTATCTTAATTTGGATA17397579AATGTTGTCAATGAAAATCATCAACCTTCTTTGCTACATTTATAA
Chr16:13417036-13417050
ATTTATTGATTTTTTATTTTAAATTTGCTT13417036AATGTTGTCAATGAAAAATATTGGACTTCTTTTTTTTTATTTGTA
Chr19:4264718-4264732
GATTTTTTTTTCTTCATCTTTATTTTGATG4264718AATGTTGTCAATGAAAAATATTAACTTTTTTTGCTACATTTGTAA
Chr21:10383271-10383285
GATTTGCTATTCTTCATCTTGGTTTTAATG10383271AATGTTGTCAATGAAAAAAATCAACCTTCTTTGCTGTATTTATAA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Ppatens_251_v3/TTCATTGACAACATT
lang : en | db : Ppatens_251_v3 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.079 | 0.071 | search_plus_done; http://172.18.8.74:28287/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.089 | 0.011 | search_minus_done; http://172.18.8.74:28287/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=35
0.093 | 0.004 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).