GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2022-12-08 11:18:54, GGGenome : Raphanus sativus genome, RSA_r1.0 (May, 2014)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Rsa1.0_00722.1
position: 40986-41000
CGTGACGCTGAAGGCCAGGATGTGTTGCTT40986TTCATTGACAACATTTTCCGTTTCACTCAGGTGAACTACTATACT
Rsa1.0_14398.1
position: 2790-2804
TTCAGAGGAGGCTCAATCTGGGTGGCGTGG2790TTCATTGACAACATTCTTTCAGGAAATCTGAGCAATCTCTGGACC
Rsa1.0_00722.1
position: 37392-37406
AGTATAGTAGTTCACCTGAGTGAAACGGAA37392AATGTTGTCAATGAAAAGCAACACATCTTGGCCTTCGGCATCACG
Rsa1.0_04468.1
position: 8947-8961
GCCGATGAACCTCCGATTCCTCTTCCGGTG8947AATGTTGTCAATGAAGTGGCGGCTGGAAATCGTTTCATTCTCATC
Rsa1.0_05732.1
position: 9140-9154
ATAGTATATAAAAACGAATTAAAAAAAATT9140AATGTTGTCAATGAAACACTAAACCCTAAACTCTAATCCTAAACC
Rsa1.0_07059.1
position: 4663-4677
AAGAACATGGCTCACCTGAGTGAAACGGAA4663AATGTTGTCAATGAACAGCAACACATCTTGACCTTCGGCATCACG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/RSA_r1.0/TTCATTGACAACATT
lang : en | db : RSA_r1.0 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.078 | 0.070 | search_plus_done; http://172.18.8.77:28239/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.083 | 0.005 | search_minus_done; http://172.18.8.77:28239/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=48
0.086 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).