GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-04 11:35:50, GGGenome : Solanum lycopersicum genome, SL2.40 (Jan, 2011)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

SL2.40ch00
position: 6031736-6031750
AAACCATTTCTGGATTCTTTTTTCATCATC6031736TTCATTGACAACATTTTGGTTTATTCGCAGAGTAAGGATGAGAAT
SL2.40ch02
position: 25012991-25013005
CAAAGTTACCTAGATTAATTTGTCATTGTC25012991TTCATTGACAACATTTTGGTATATTAGAAAAATAAGGGAGATCAC
SL2.40ch04
position: 8488870-8488884
CACGAACTATATTCAACATTTTAGTCAAAA8488870TTCATTGACAACATTATATATGTACAAAATTTGTATAAAATTATT
SL2.40ch05
position: 60129746-60129760
AAGACAACGTGACAAAATTGAAATTTCTAG60129746TTCATTGACAACATTTTAATTAATAACAATTCAATCAATTTTATG
SL2.40ch05
position: 62317047-62317061
CAGAATTCAATGAAAGTCGCGAACATACAC62317047TTCATTGACAACATTTTATTGGGCCAGGGTCCAATATTGAGCAAA
SL2.40ch07
position: 65013624-65013638
TAATCACAATGGAAGCAAGAATGACAAGTT65013624TTCATTGACAACATTATCCATCACCTGTGACCTATAGCTCATGGG
SL2.40ch08
position: 49510287-49510301
CAACGTAACTTAGAAGCTTTCCTCAAATAC49510287TTCATTGACAACATTTTCAATCATATCAATTAAAATATAAGTTTT
SL2.40ch10
position: 22046165-22046179
AGAAGTTACCTAAATTCATTTGTCATTGTC22046165TTCATTGACAACATTTTGGTATATTCAAAAAATGTGGGTGAACAC
SL2.40ch12
position: 63771012-63771026
AACAAAATAATTGACTCTAAGCTAAAATAA63771012TTCATTGACAACATTTTCTTGCCATGTCCTTGTGTAAATGATCTC
SL2.40ch03
position: 37088237-37088251
GTGATCACCCTCATTTTTTGAATATACAAA37088237AATGTTGTCAATGAAGACAATGAAAAATGAATCTAGGTAATTTCA
SL2.40ch03
position: 61439872-61439886
TTGTTTTATTGAATTAAATTTTAATCAGTA61439872AATGTTGTCAATGAAGTGCTCAATGGTGTGGCCTAGTGGTTAATG
SL2.40ch06
position: 41470972-41470986
GGTTCTAATCAACTCAAGTTTTGGAAAGAA41470972AATGTTGTCAATGAAATGCCTCCATCTCTTGTTTCTAAATTATCT
SL2.40ch09
position: 9990821-9990835
TGAGTGATAGAGTAGAAGCATATATCTGAT9990821AATGTTGTCAATGAATAAGAAATTCAACACCACAAAGTAATGAAC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/SL2.4/TTCATTGACAACATT
lang : en | db : SL2.4 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.084 | 0.078 | search_plus_done; http://172.18.8.72:28275/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.095 | 0.011 | search_minus_done; http://172.18.8.72:28275/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=41
0.097 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).