GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-04 11:05:01, GGGenome : Solanum lycopersicum str. Heinz 1706 genome, SL2.50 (Oct, 2014)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

2 dna:chromosome chromosome:GCA_000188115.2:2:1:55340444:1
position: 4578581-4578595
CAAAGTTACCTAGATTAATTTGTCATTGTC4578581TTCATTGACAACATTTTGGTATATTAGAAAAATAAGGGAGATCAC
4 dna:chromosome chromosome:GCA_000188115.2:4:1:66470942:1
position: 8488870-8488884
CACGAACTATATTCAACATTTTAGTCAAAA8488870TTCATTGACAACATTATATATGTACAAAATTTGTATAAAATTATT
5 dna:chromosome chromosome:GCA_000188115.2:5:1:65875088:1
position: 60983396-60983410
AAGACAACGTGACAAAATTGAAATTTCTAG60983396TTCATTGACAACATTTTAATTAATAACAATTCAATCAATTTTATG
5 dna:chromosome chromosome:GCA_000188115.2:5:1:65875088:1
position: 63170697-63170711
CAGAATTCAATGAAAGTCGCGAACATACAC63170697TTCATTGACAACATTTTATTGGGCCAGGGTCCAATATTGAGCAAA
7 dna:chromosome chromosome:GCA_000188115.2:7:1:68045021:1
position: 67790024-67790038
TAATCACAATGGAAGCAAGAATGACAAGTT67790024TTCATTGACAACATTATCCATCACCTGTGACCTATAGCTCATGGG
8 dna:chromosome chromosome:GCA_000188115.2:8:1:65866657:1
position: 52301137-52301151
CAACGTAACTTAGAAGCTTTCCTCAAATAC52301137TTCATTGACAACATTTTCAATCATATCAATTAAAATATAAGTTTT
10 dna:chromosome chromosome:GCA_000188115.2:10:1:65527505:1
position: 26571507-26571521
AGAAGTTACCTAAATTCATTTGTCATTGTC26571507TTCATTGACAACATTTTGGTATATTCAAAAAATGTGGGTGAACAC
12 dna:chromosome chromosome:GCA_000188115.2:12:1:67145203:1
position: 65429962-65429976
AACAAAATAATTGACTCTAAGCTAAAATAA65429962TTCATTGACAACATTTTCTTGCCATGTCCTTGTGTAAATGATCTC
SL2.40sc05224 dna:supercontig supercontig:GCA_000188115.2:SL2.40sc05224:1:797762:1
position: 294467-294481
AAACCATTTCTGGATTCTTTTTTCATCATC294467TTCATTGACAACATTTTGGTTTATTCGCAGAGTAAGGATGAGAAT
3 dna:chromosome chromosome:GCA_000188115.2:3:1:70787664:1
position: 39711678-39711692
GTGATCACCCTCATTTTTTGAATATACAAA39711678AATGTTGTCAATGAAGACAATGAAAAATGAATCTAGGTAATTTCA
3 dna:chromosome chromosome:GCA_000188115.2:3:1:70787664:1
position: 67386822-67386836
TTGTTTTATTGAATTAAATTTTAATCAGTA67386822AATGTTGTCAATGAAGTGCTCAATGGTGTGGCCTAGTGGTTAATG
6 dna:chromosome chromosome:GCA_000188115.2:6:1:49751636:1
position: 45081072-45081086
GGTTCTAATCAACTCAAGTTTTGGAAAGAA45081072AATGTTGTCAATGAAATGCCTCCATCTCTTGTTTCTAAATTATCT
9 dna:chromosome chromosome:GCA_000188115.2:9:1:72482091:1
position: 9990821-9990835
TGAGTGATAGAGTAGAAGCATATATCTGAT9990821AATGTTGTCAATGAATAAGAAATTCAACACCACAAAGTAATGAAC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/SL2.50/TTCATTGACAACATT
lang : en | db : SL2.50 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.077 | 0.071 | search_plus_done; http://172.18.8.75:28197/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.086 | 0.009 | search_minus_done; http://172.18.8.75:28197/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=41
0.088 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).