GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2022-12-06 10:23:53, GGGenome : Solanum melongena genome, r2.5.1

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Sme2.5_00030.1
position: 182888-182902
AGATAATTTAGAAAGAAGAGCTTGAGGCAT182888TTCATTGACAACATTTTCTTTCCAAAACTTGAGCTGATTAGAACC
Sme2.5_00706.1
position: 65345-65359
AGATAATATTTGGATATATGTATGATCATG65345TTCATTGACAACATTTTGGTTCATTCGAAAGATGGGGAGGAGTAT
Sme2.5_01203.1
position: 74314-74328
AACCATACTCATCTCCGTAGGAAACTCAAA74314TTCATTGACAACATTACTAATTCTCCTCAAAATTCTATAAGGCCC
Sme2.5_01284.1
position: 8081-8095
TATGACTCGAAGAAAGATTTTTCTTTTGAT8081TTCATTGACAACATTATAATTAACATGATGGAGGTGGTTCAGAAA
Sme2.5_09060.1
position: 17584-17598
AGACAGTATCTTGATATGTTTGTGATTGTG17584TTCATTGACAACATTTTGGTGTATTCAAGAGGTGAAGAGAAGCAT
Sme2.5_00472.1
position: 55616-55630
GTGCTCCTCCTTATCTCTCGAATACACCAA55616AATGTTGTCAATGAACATAATCACAAACATATCAAGATATTGTCT
Sme2.5_01115.1
position: 200005-200019
TGTAAAACACGAGGGCCTTGGACACTCTAT200005AATGTTGTCAATGAAGCATGAACTGAACCTCATTTACTCATAACT
Sme2.5_01485.1
position: 88839-88853
GAATCTGCAAAAGATCGCATGGACATTGCC88839AATGTTGTCAATGAACTAAGGGCAATCAAAGATGCTTTCCTGAGG
Sme2.5_02866.1
position: 51624-51638
ATGCTCCTCCTTATCTCTTGAATACACCAA51624AATGTTGTCAATGAATACAATCACAAATATATCAAGATATTGTCT
Sme2.5_04594.1
position: 67623-67637
AAGGCTTTATGGTAAGGCACGTGATTTATG67623AATGTTGTCAATGAAGGAAAATTAAGCATGCTATGAGTTCATGAG
Sme2.5_10761.1
position: 13408-13422
ATGCTCCTCCTCATTCCTAGAATACACCAA13408AATGTTGTCAATGAACACAATCATGAACATGTCAAGATACTACCT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/SME_r2.5.1/TTCATTGACAACATT
lang : en | db : SME_r2.5.1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.079 | 0.071 | search_plus_done; http://172.18.8.72:28211/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.086 | 0.007 | search_minus_done; http://172.18.8.72:28211/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=45
0.089 | 0.004 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).