GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-04 11:45:45, GGGenome : Solanum tuberosum genome, SolTub_3.0 (May, 2011)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

1 dna:chromosome chromosome:3.0:1:1:88663952:1
position: 81696348-81696362
GGAACTCCAATAAATAAAAGGGAAGCCATT81696348TTCATTGACAACATTTGCCACTATTATATTACTTAAAGACAGAAG
6 dna:chromosome chromosome:3.0:6:1:59532096:1
position: 56730662-56730676
AAATGGTGTCACCAGCTTAATTCAAATATT56730662TTCATTGACAACATTTTTATTTTGGATTTGTAGGCCGGTAAACCA
11 dna:chromosome chromosome:3.0:11:1:45475667:1
position: 16503476-16503490
TCCTGCAAGTTCACCAATCTTGGAATTAGG16503476TTCATTGACAACATTTTTATTCATGTCTTTCATATCTAGTGTTTG
1 dna:chromosome chromosome:3.0:1:1:88663952:1
position: 86622918-86622932
ACTAGCACTACTTATTATACCTTTTTAATT86622918AATGTTGTCAATGAATAACAGGATTGAGAGAATGAGAAATTATAT
4 dna:chromosome chromosome:3.0:4:1:72208621:1
position: 26658799-26658813
TCACAAAATCAAACCAACTATGATGTAGTA26658799AATGTTGTCAATGAAGAACCTATTGATGAGAACCTGAAACATGTG
6 dna:chromosome chromosome:3.0:6:1:59532096:1
position: 53737595-53737609
GGTTCTAATGAGCTCAAGTTTTGGAAAGAA53737595AATGTTGTCAATGAAATGCCTCAAGCTCTTGTTTCTAAATTATCT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/SolTub_3.0/TTCATTGACAACATT
lang : en | db : SolTub_3.0 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.079 | 0.072 | search_plus_done; http://172.18.8.75:28198/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.084 | 0.005 | search_minus_done; http://172.18.8.75:28198/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=47
0.085 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).