GGGenome | Results

Help | Japanese

2025-04-04 12:18:37, GGGenome : Sorghum bicolor genome, Sorbi1 (Dec, 2007)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and in~~dels~~ are marked in red.

7 dna:chromosome chromosome:Sorbi1:7:1:64342021:1
position: 59442799-59442813

TCAGGATTTCAGCACCATACACTGTGGGGC59442799AATGTTGTCAATGAACTGATAAGCAATATTAACTGTACATAGGTG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Tab-delimited text: Open in new window | Download
You can copy-paste the result into spreadsheet softwares (e.g. Excel) or text editors.
CSV format: Open in new window | Download
You can open CSV files using spreadsheet softwares (e.g. Excel) or text editors.
BED format: Link | Download
GFF format: Link | Download
JSON format: Link | Download

Debug Info:

0.009 | 0.009 | search_start;
0.080 | 0.072 | search_plus_done; http://172.18.8.75:28199/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.084 | 0.003 | search_minus_done; http://172.18.8.75:28199/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.085 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).