GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-04-20 10:16:00, GGGenome : Glycine max genome, V1.0 EnsemblPlants (Jan, 2010)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

1 dna:chromosome chromosome:V1.0:1:1:55915595:1
position: 6332453-6332467
TTCACAATTACCGTCAGCTTTCACATTCAC6332453AATGTTGTCAATGAAACCCTGTATAAATGGCTCAAATTGATCCAA
1 dna:chromosome chromosome:V1.0:1:1:55915595:1
position: 7970648-7970662
TCCATAGTTTCCGTCAGCTTTGACATCCAC7970648AATGTTGTCAATGAAATCGTGGATAAATGGCTGAATTGATCCAAC
1 dna:chromosome chromosome:V1.0:1:1:55915595:1
position: 42201909-42201923
TCCATAGTTTCCGTCAGGTTTGACATCCAC42201909AATGTTGTCAATGAAATCTTGCATAAATGGCTGAAATTGATCCAA
2 dna:chromosome chromosome:V1.0:2:1:51656713:1
position: 25639929-25639943
TCCATAGTTACCATATGCTTTCACATCCAC25639929AATGTTGTCAATGAAATCCTGTATAAATGGCTCAAATTGATGCAC
2 dna:chromosome chromosome:V1.0:2:1:51656713:1
position: 27259080-27259094
TCTACAGTTACCGTCCGTTTTCACATCCAC27259080AATGTTGTCAATGAAACCCTGTATAAATGACTCAAATTGATCCAA
3 dna:chromosome chromosome:V1.0:3:1:47781076:1
position: 21049424-21049438
ATGTTTGTTTCACATGTTGCCACTTCATCA21049424AATGTTGTCAATGAACTTCCTTAAATGTTTTCAATTTTGGAATGA
3 dna:chromosome chromosome:V1.0:3:1:47781076:1
position: 25115889-25115903
CCCACAGTTTCTGTTAGCTTTGACATCGAC25115889AATGTTGTCAATGAAATCGTGGATAAATGGCTAAAATTGATCCAA
4 dna:chromosome chromosome:V1.0:4:1:49243852:1
position: 8210809-8210823
TCCATAGTTACCATCCGCTTTCACATCCAT8210809AATGTTGTCAATGAAATCCTGTATAAATTGCTCAAATTGATCCAA
4 dna:chromosome chromosome:V1.0:4:1:49243852:1
position: 9868682-9868696
TCCATAGTTTCCGTCAGGTTTGACATCCAC9868682AATGTTGTCAATGAAATCCTGCATAAATGGCTGAAATTGATCCAA
4 dna:chromosome chromosome:V1.0:4:1:49243852:1
position: 13281811-13281825
TTTTTTACAACATCGATTTTACAAAACATC13281811AATGTTGTCAATGAAGAACAACATTGGTTTTTATTAAAACCGATG
4 dna:chromosome chromosome:V1.0:4:1:49243852:1
position: 31620022-31620036
TCCACAGTTATCGTCAGCTTTGACATCCAC31620022AATGTTGTCAATGAAATCATGTATAAACAAATGAAATTGATCCAA
4 dna:chromosome chromosome:V1.0:4:1:49243852:1
position: 43197449-43197463
TCCACAGTTACCGTCAACTTTGACATCCAC43197449AATGTTGTCAATGAAATCGTGTATAAACGGCTGAAATTGATCCAA
7 dna:chromosome chromosome:V1.0:7:1:44683157:1
position: 15051018-15051032
TCCACAGTTACTGTCAGCTTTCACATCCAC15051018AATGTTGTCAATGAAATCCTATATAAATGGCTCAAATTGATCCAA
7 dna:chromosome chromosome:V1.0:7:1:44683157:1
position: 18228155-18228169
TTGAGTTTGAGACAATGATTGGGTAAGCCA18228155AATGTTGTCAATGAATTAAGAAATTCAGTTGTGAGTGAGCGAAAA
7 dna:chromosome chromosome:V1.0:7:1:44683157:1
position: 26254496-26254510
TCCACAGTTACCGTCAGCTTTCACATCCAC26254496AATGTTGTCAATGAAACCCTGTATATAAATGGCTTAAATTGATCC
7 dna:chromosome chromosome:V1.0:7:1:44683157:1
position: 39638884-39638898
TCCACAGTTTCCATCAACTTTGACATCCAC39638884AATGTTGTCAATGAAGTCGTGGATAAATGACTGAAATTGATCCAA
8 dna:chromosome chromosome:V1.0:8:1:46995532:1
position: 19299233-19299247
TCCACAGTTACCATCCGCTTTCACATCCAC19299233AATGTTGTCAATGAAACCTTGTATAAATGACTCAAATTGATCCAA
8 dna:chromosome chromosome:V1.0:8:1:46995532:1
position: 19417571-19417585
TCCATAGTTACCGTCAGCTTTGACATCCAC19417571AATGTTGTCAATGAAATCGTGGATAAATGGTTGAAATTGATCCAA
8 dna:chromosome chromosome:V1.0:8:1:46995532:1
position: 36126739-36126753
TCCATAGTTACCGTCAGCTTTGACATCCAC36126739AATGTTGTCAATGAACTATGCTTCATCGAAGAATTACTATTTTGC
10 dna:chromosome chromosome:V1.0:10:1:50969635:1
position: 8539720-8539734
TCCACAGTTACCATTCGCTTTAACATCCAC8539720AATGTTGTCAATGAAACCCTGTATAAATGGCTCAAATTGATCCAA
10 dna:chromosome chromosome:V1.0:10:1:50969635:1
position: 12266537-12266551
TCCACAGTTACCGTCAACTTTGACATCCAC12266537AATGTTGTCAATGAAATCGTGTATAAACGGATGAAATTGATTCAA
10 dna:chromosome chromosome:V1.0:10:1:50969635:1
position: 31731920-31731934
TCCACAGTTACCGTCCGCTTTCACATCTAC31731920AATGTTGTCAATGAAACCTTGTATAAATGGCTTAAATTGATCCAA
12 dna:chromosome chromosome:V1.0:12:1:40113140:1
position: 32626029-32626043
TCCACAGTTATCGTCAGCTTTGACATCCAC32626029AATGTTGTCAATGAACTCGTGTATAAACGGCTGAAATTGATCCAA
12 dna:chromosome chromosome:V1.0:12:1:40113140:1
position: 33587951-33587965
TCCACAGTTTCCGTCAGGTTTGACATCCAC33587951AATGTTGTCAATGAAATCCTACATAAATGGCTGAAATTGATCCAA
12 dna:chromosome chromosome:V1.0:12:1:40113140:1
position: 34072016-34072030
TCCACAGTTACCGTCTACTTTCACATCCAC34072016AATGTTGTCAATGAAATCTTGTATAAATGGCTCAAATTGATCCAA
12 dna:chromosome chromosome:V1.0:12:1:40113140:1
position: 39755573-39755587
CAAAAAACAACATTAATTTAAAAAAAAACC39755573AATGTTGTCAATGAAAAACAAAATCGGTTTTTCTTAAAATCAATG
13 dna:chromosome chromosome:V1.0:13:1:44408971:1
position: 8542456-8542470
TCCACAGTTTCCATCAGCTTTGACATCCAC8542456AATGTTGTCAATGAAGTCGTGGAAAAATCGCTGAAATTGATCCAA
13 dna:chromosome chromosome:V1.0:13:1:44408971:1
position: 11093594-11093608
TCCACAGTTTTTATCAGCTTTGACATCAAT11093594AATGTTGTCAATGAAGTCGTGGATAAATGGCTGAAATTGATCCAA
13 dna:chromosome chromosome:V1.0:13:1:44408971:1
position: 16693525-16693539
TCCACAGTTACCATCAGCTTTCACATCCAC16693525AATGTTGTCAATGAAATCCTATATAAATGGCCCAAATTGATCCAA
15 dna:chromosome chromosome:V1.0:15:1:50939160:1
position: 14562806-14562820
TCCACAATTTTCATTAGGTTTGACATCCAC14562806AATGTTGTCAATGAAATCCTGGATAAATGGCTGAAATTGATCCAA
15 dna:chromosome chromosome:V1.0:15:1:50939160:1
position: 21342038-21342052
TCCACAGTTACCGTCAGCTTTGACATCCAC21342038AATGTTGTCAATGAAATCATGTATAAATGGCTGAAATTGATCCAA
17 dna:chromosome chromosome:V1.0:17:1:41906774:1
position: 29373170-29373184
TCCAAAGTTACCATCCACTTTCACATCCAC29373170AATGTTGTCAATGAAACCCTGTATAAATGGCTCAAATTGATCCGA
17 dna:chromosome chromosome:V1.0:17:1:41906774:1
position: 31269351-31269365
TCCACAGTTATCGTCAGCTTTGACATCCAC31269351AATGTTGTCAATGAAATCATGTATAAATGGATGAAATTAATCCAA
18 dna:chromosome chromosome:V1.0:18:1:62308140:1
position: 43413502-43413516
CTATATCATACCGTCCACTTTCACATCCAC43413502AATGTTGTCAATGAAACCCTGTATAAATGGCTCAAATTGATCCAA
18 dna:chromosome chromosome:V1.0:18:1:62308140:1
position: 48694111-48694125
TCCATAGTTACCGTTTGCTTTCACATCCAC48694111AATGTTGTCAATGAAACCCTGTATAAATGACTCAAATTAATTCAA
19 dna:chromosome chromosome:V1.0:19:1:50589441:1
position: 5807679-5807693
ACTACTGGTTTAGTAGGTGCTGATCTGGCA5807679AATGTTGTCAATGAAGCCGCGTTGCTTGCTGCTCGTAGAGGTAAC
19 dna:chromosome chromosome:V1.0:19:1:50589441:1
position: 22741086-22741100
TCCACAATTACCATCCGCTTTCACATCCAC22741086AATGTTGTCAATGAAACCCTGTATAAATGGCTCAAATTAATCCAA
20 dna:chromosome chromosome:V1.0:20:1:46773167:1
position: 11746048-11746062
ATCTAAGGTTTACTAGGTAGTGATCTGGCA11746048AATGTTGTCAATGAAGCTGTGTTGCTTGCTACTTGTAGAGGTAAC
20 dna:chromosome chromosome:V1.0:20:1:46773167:1
position: 30235299-30235313
TCCATAGTTACCATCAGCTTTGACATCCAC30235299AATGTTGTCAATGAAATCGTGTATAAATGGCTAAAATTGATCCAA
20 dna:chromosome chromosome:V1.0:20:1:46773167:1
position: 46236726-46236740
TTGGTGCTTAATTAGCCTTCTTTTTTTCAC46236726AATGTTGTCAATGAAATTCGAAATCATGCCTATATATATACTCAC
1 dna:chromosome chromosome:V1.0:1:1:55915595:1
position: 16753869-16753883
TTGGATCAATTTCATCCATTTATACATGAT16753869TTCATTGACAACATTGTGGATGTCAAAGCTGACAATAACTGTGGA
1 dna:chromosome chromosome:V1.0:1:1:55915595:1
position: 27206108-27206122
TTGGATCAATTTGAGCCATTTATACAGGGT27206108TTCATTGACAACATTGTGGATGTGAAAGCAGACAACAATTGTGGA
2 dna:chromosome chromosome:V1.0:2:1:51656713:1
position: 8266921-8266935
GTGGATCAATTTCATCCTGTTATACACGAT8266921TTCATTGACAACATTGTGGATGTCAAAGCTGACGGTAACTGTGGA
3 dna:chromosome chromosome:V1.0:3:1:47781076:1
position: 2390563-2390577
TTCGATCAATTACATTCATTTATACACAAT2390563TTCATTGACAACATTGTGGATGTCAAAGCTGATAGTAACTGTGGA
3 dna:chromosome chromosome:V1.0:3:1:47781076:1
position: 12001648-12001662
TTGGATCAATTTCAACCATTTATACACAAT12001648TTCATTGACAACATTGTAGATGCCAAAACTGACAGTAACTGTGGA
4 dna:chromosome chromosome:V1.0:4:1:49243852:1
position: 6912151-6912165
TTGGATCAATTTCATCCGTTTATACATGAT6912151TTCATTGACAACATTGTGGATGCCAAAGCTGACGGTAACTGTGGA
4 dna:chromosome chromosome:V1.0:4:1:49243852:1
position: 8233473-8233487
TTGGATCAATTTCATCCGTTTATACATGAT8233473TTCATTGACAACATTGTGGATGTCAAAGCTGACGGTAACTGTGGA
4 dna:chromosome chromosome:V1.0:4:1:49243852:1
position: 27580682-27580696
TTGGATCAATTTCAGCCATTTATACACGAC27580682TTCATTGACAACATTATGGATGTCAAAGCTTATAGTAACTGTGGA
4 dna:chromosome chromosome:V1.0:4:1:49243852:1
position: 33547315-33547329
GTTACCTCTACGAGCAGCAAGCAACACAAC33547315TTCATTGACAACATTTTCCAGACAACGTTTGCCATCTACCCCAGC
5 dna:chromosome chromosome:V1.0:5:1:41936504:1
position: 11116377-11116391
TTGGATCAATTTCAGCCATTTATCCACGAC11116377TTCATTGACAACATTATTGATGTCCAAGCTGATGGAAACTATGGG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Soybn_V1.0/AATGTTGTCAATGAA
lang : en | db : Soybn_V1.0 | k : 0 | strand : | nogap : | query_string : AATGTTGTCAATGAA | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.082 | 0.074 | search_plus_done; http://172.18.8.75:28175/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.108 | 0.026 | search_minus_done; http://172.18.8.75:28175/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=10
0.114 | 0.006 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).