GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-12-06 04:24:38, GGGenome : Glycine max genome, V1.0 EnsemblPlants (Jan, 2010)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

1 dna:chromosome chromosome:V1.0:1:1:55915595:1
position: 16753869-16753883
TTGGATCAATTTCATCCATTTATACATGAT16753869TTCATTGACAACATTGTGGATGTCAAAGCTGACAATAACTGTGGA
1 dna:chromosome chromosome:V1.0:1:1:55915595:1
position: 27206108-27206122
TTGGATCAATTTGAGCCATTTATACAGGGT27206108TTCATTGACAACATTGTGGATGTGAAAGCAGACAACAATTGTGGA
2 dna:chromosome chromosome:V1.0:2:1:51656713:1
position: 8266921-8266935
GTGGATCAATTTCATCCTGTTATACACGAT8266921TTCATTGACAACATTGTGGATGTCAAAGCTGACGGTAACTGTGGA
3 dna:chromosome chromosome:V1.0:3:1:47781076:1
position: 2390563-2390577
TTCGATCAATTACATTCATTTATACACAAT2390563TTCATTGACAACATTGTGGATGTCAAAGCTGATAGTAACTGTGGA
3 dna:chromosome chromosome:V1.0:3:1:47781076:1
position: 12001648-12001662
TTGGATCAATTTCAACCATTTATACACAAT12001648TTCATTGACAACATTGTAGATGCCAAAACTGACAGTAACTGTGGA
4 dna:chromosome chromosome:V1.0:4:1:49243852:1
position: 6912151-6912165
TTGGATCAATTTCATCCGTTTATACATGAT6912151TTCATTGACAACATTGTGGATGCCAAAGCTGACGGTAACTGTGGA
4 dna:chromosome chromosome:V1.0:4:1:49243852:1
position: 8233473-8233487
TTGGATCAATTTCATCCGTTTATACATGAT8233473TTCATTGACAACATTGTGGATGTCAAAGCTGACGGTAACTGTGGA
4 dna:chromosome chromosome:V1.0:4:1:49243852:1
position: 27580682-27580696
TTGGATCAATTTCAGCCATTTATACACGAC27580682TTCATTGACAACATTATGGATGTCAAAGCTTATAGTAACTGTGGA
4 dna:chromosome chromosome:V1.0:4:1:49243852:1
position: 33547315-33547329
GTTACCTCTACGAGCAGCAAGCAACACAAC33547315TTCATTGACAACATTTTCCAGACAACGTTTGCCATCTACCCCAGC
5 dna:chromosome chromosome:V1.0:5:1:41936504:1
position: 11116377-11116391
TTGGATCAATTTCAGCCATTTATCCACGAC11116377TTCATTGACAACATTATTGATGTCCAAGCTGATGGAAACTATGGG
6 dna:chromosome chromosome:V1.0:6:1:50722821:1
position: 18064307-18064321
TTAGATCAATTTTAGCCATTTATACACGAT18064307TTCATTGACAACATTGTGGATGTCAAAGCTGACGGTAACTGTGGA
6 dna:chromosome chromosome:V1.0:6:1:50722821:1
position: 20687336-20687350
TTAGATCAATTTGAGCCATTTATACAGGGT20687336TTCATTGACAACATTGTGGATGTGGTAGCGGACGGTAACTGTGGA
7 dna:chromosome chromosome:V1.0:7:1:44683157:1
position: 10630367-10630381
TTGGATCAATTTGAGCCATTTATATAGGGT10630367TTCATTGACAACATTGTGGATGTGAAAGCGGATGATAACTGTGGA
7 dna:chromosome chromosome:V1.0:7:1:44683157:1
position: 28659464-28659478
TTGGATCAATTTCAGCCATTTATACACGAT28659464TTCATTGACAACATTGTGGATGTCAAAGCTGACAGTAACTTTTTA
7 dna:chromosome chromosome:V1.0:7:1:44683157:1
position: 31645600-31645614
TTGGATTAATTTGAGCCATTTATACAGGGT31645600TTCATTGACAACATTGTGGATGTGAAAGCAGATGATAACTGTAGA
8 dna:chromosome chromosome:V1.0:8:1:46995532:1
position: 30137301-30137315
TTGGATCAATTTTAGTCGTTTATACACGAT30137301TTCATTGACAACATTGTGGATGTCAAAGCTGAAGGTAACCATGGA
8 dna:chromosome chromosome:V1.0:8:1:46995532:1
position: 32765524-32765538
TTGGATCAGTTTCATCCATTTATACACGAT32765524TTCATTGACAACATTGTGGATGTCAAAGTTGACGGTAACTGTAAA
10 dna:chromosome chromosome:V1.0:10:1:50969635:1
position: 33695060-33695074
TTGGATCAATTTCAGCCATTTATACACGAT33695060TTCATTGACAACATTGTGGATGTCAAAGCTGACGGTAACTGTGGA
10 dna:chromosome chromosome:V1.0:10:1:50969635:1
position: 39311030-39311044
TTGGATCAATTTCATCTGTTTATACACGAT39311030TTCATTGACAACATTGTGGATGTCAAAGCTAACGGTAACTGTGGA
11 dna:chromosome chromosome:V1.0:11:1:39172790:1
position: 12263771-12263785
ATTTTCATTATGACAAACAACATCCCCACT12263771TTCATTGACAACATTTTGACTCCCTCCATCATCAACTACATCATT
11 dna:chromosome chromosome:V1.0:11:1:39172790:1
position: 26004212-26004226
TTGTACAACAATCAAAGAAATATACACGAT26004212TTCATTGACAACATTGTGGATGTCAAAGGTGACGGTAACTGTGGA
12 dna:chromosome chromosome:V1.0:12:1:40113140:1
position: 12773741-12773755
TTGGATCAATTTGAGCCATTTATACAGGGT12773741TTCATTGACAACATTGTGGATGTGAAAGCGGACGGTAATTGAAGA
12 dna:chromosome chromosome:V1.0:12:1:40113140:1
position: 36955447-36955461
AGGAAGAGTGTAAGGGAAGGAAAAAATAAA36955447TTCATTGACAACATTTTTCTAGTTTGAGTACCCTGTTTAGTAAAG
13 dna:chromosome chromosome:V1.0:13:1:44408971:1
position: 19036262-19036276
TTGGACCAATTTCAGCCATTTATGTAGGAT19036262TTCATTGACAACATTGTGGATGTCAAACTTGACAGAAACTGTGGG
14 dna:chromosome chromosome:V1.0:14:1:49711204:1
position: 42972490-42972504
TTGGATCAATTTGAACCATTTATACAGGGT42972490TTCATTGACAACATTGTGGATGTGAAAGCGGACGGTAATTGTGGA
16 dna:chromosome chromosome:V1.0:16:1:37397385:1
position: 14393220-14393234
TTGGATCAATTTCAGTCATTTATCCACGAC14393220TTCATTGACAACATTGTGGATGTCAAAGCTGACGGAAACTGTGGA
16 dna:chromosome chromosome:V1.0:16:1:37397385:1
position: 14680639-14680653
TTGGATCAATTTCAACCGTTTATACACGAT14680639TTCATTGACAACATTGTGGATGTCAAAGCTGACGATAACTGTGGA
18 dna:chromosome chromosome:V1.0:18:1:62308140:1
position: 17283356-17283370
TTTTAGCTCACTAACTATTGAATTTCTCAG17283356TTCATTGACAACATTTGTCCTATCAAGTCATTCTATCAAACTTAA
18 dna:chromosome chromosome:V1.0:18:1:62308140:1
position: 33125550-33125564
GTTACCTCTATGAGCAACAAGCAACACAGC33125550TTCATTGACAACATTTTCCAGACAACGTTTGCCATCTACCCCAGC
18 dna:chromosome chromosome:V1.0:18:1:62308140:1
position: 51593830-51593844
AACAATAATAGGAGTACAACTAAGTCAAAA51593830TTCATTGACAACATTCTAGTTGTTGAGGAAAGAGTTCAGAATAGG
19 dna:chromosome chromosome:V1.0:19:1:50589441:1
position: 33521274-33521288
TTGGATCAATTTGAGCCATTTATACAAGGT33521274TTCATTGACAACATTGTGGATGTGAAAGCTAACGGTAACTGTGGA
19 dna:chromosome chromosome:V1.0:19:1:50589441:1
position: 35685570-35685584
TTGGATCAATTTCAGCCATTTATCCACGAT35685570TTCATTGACAACATTGTCAATGTCAAAGCTGACGAAAACTGTGGA
scaffold_28 dna:scaffold scaffold:V1.0:scaffold_28:1:378823:1
position: 209871-209885
TTGGATCAATTTGAGCCATTTATACAGGGT209871TTCATTGACAACATTATGGATATGAAAGTAGACGGTAACTATGGA
1 dna:chromosome chromosome:V1.0:1:1:55915595:1
position: 6332453-6332467
TTCACAATTACCGTCAGCTTTCACATTCAC6332453AATGTTGTCAATGAAACCCTGTATAAATGGCTCAAATTGATCCAA
1 dna:chromosome chromosome:V1.0:1:1:55915595:1
position: 7970648-7970662
TCCATAGTTTCCGTCAGCTTTGACATCCAC7970648AATGTTGTCAATGAAATCGTGGATAAATGGCTGAATTGATCCAAC
1 dna:chromosome chromosome:V1.0:1:1:55915595:1
position: 42201909-42201923
TCCATAGTTTCCGTCAGGTTTGACATCCAC42201909AATGTTGTCAATGAAATCTTGCATAAATGGCTGAAATTGATCCAA
2 dna:chromosome chromosome:V1.0:2:1:51656713:1
position: 25639929-25639943
TCCATAGTTACCATATGCTTTCACATCCAC25639929AATGTTGTCAATGAAATCCTGTATAAATGGCTCAAATTGATGCAC
2 dna:chromosome chromosome:V1.0:2:1:51656713:1
position: 27259080-27259094
TCTACAGTTACCGTCCGTTTTCACATCCAC27259080AATGTTGTCAATGAAACCCTGTATAAATGACTCAAATTGATCCAA
3 dna:chromosome chromosome:V1.0:3:1:47781076:1
position: 21049424-21049438
ATGTTTGTTTCACATGTTGCCACTTCATCA21049424AATGTTGTCAATGAACTTCCTTAAATGTTTTCAATTTTGGAATGA
3 dna:chromosome chromosome:V1.0:3:1:47781076:1
position: 25115889-25115903
CCCACAGTTTCTGTTAGCTTTGACATCGAC25115889AATGTTGTCAATGAAATCGTGGATAAATGGCTAAAATTGATCCAA
4 dna:chromosome chromosome:V1.0:4:1:49243852:1
position: 8210809-8210823
TCCATAGTTACCATCCGCTTTCACATCCAT8210809AATGTTGTCAATGAAATCCTGTATAAATTGCTCAAATTGATCCAA
4 dna:chromosome chromosome:V1.0:4:1:49243852:1
position: 9868682-9868696
TCCATAGTTTCCGTCAGGTTTGACATCCAC9868682AATGTTGTCAATGAAATCCTGCATAAATGGCTGAAATTGATCCAA
4 dna:chromosome chromosome:V1.0:4:1:49243852:1
position: 13281811-13281825
TTTTTTACAACATCGATTTTACAAAACATC13281811AATGTTGTCAATGAAGAACAACATTGGTTTTTATTAAAACCGATG
4 dna:chromosome chromosome:V1.0:4:1:49243852:1
position: 31620022-31620036
TCCACAGTTATCGTCAGCTTTGACATCCAC31620022AATGTTGTCAATGAAATCATGTATAAACAAATGAAATTGATCCAA
4 dna:chromosome chromosome:V1.0:4:1:49243852:1
position: 43197449-43197463
TCCACAGTTACCGTCAACTTTGACATCCAC43197449AATGTTGTCAATGAAATCGTGTATAAACGGCTGAAATTGATCCAA
7 dna:chromosome chromosome:V1.0:7:1:44683157:1
position: 15051018-15051032
TCCACAGTTACTGTCAGCTTTCACATCCAC15051018AATGTTGTCAATGAAATCCTATATAAATGGCTCAAATTGATCCAA
7 dna:chromosome chromosome:V1.0:7:1:44683157:1
position: 18228155-18228169
TTGAGTTTGAGACAATGATTGGGTAAGCCA18228155AATGTTGTCAATGAATTAAGAAATTCAGTTGTGAGTGAGCGAAAA
7 dna:chromosome chromosome:V1.0:7:1:44683157:1
position: 26254496-26254510
TCCACAGTTACCGTCAGCTTTCACATCCAC26254496AATGTTGTCAATGAAACCCTGTATATAAATGGCTTAAATTGATCC
7 dna:chromosome chromosome:V1.0:7:1:44683157:1
position: 39638884-39638898
TCCACAGTTTCCATCAACTTTGACATCCAC39638884AATGTTGTCAATGAAGTCGTGGATAAATGACTGAAATTGATCCAA
8 dna:chromosome chromosome:V1.0:8:1:46995532:1
position: 19299233-19299247
TCCACAGTTACCATCCGCTTTCACATCCAC19299233AATGTTGTCAATGAAACCTTGTATAAATGACTCAAATTGATCCAA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Soybn_V1.0/TTCATTGACAACATT
lang : en | db : Soybn_V1.0 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.079 | 0.072 | search_plus_done; http://172.18.8.75:28175/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.102 | 0.023 | search_minus_done; http://172.18.8.75:28175/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=17
0.111 | 0.009 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).