GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-11-29 11:17:51, GGGenome : Glycine max genome, v2.0 EnsemblPlants (Nov, 2015)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

1 dna:chromosome chromosome:Glycine_max_v2.0:1:1:56831395:1 REF
position: 25668196-25668210
TTGGATCAATTTGAGCCATTTATACAGGGT25668196TTCATTGACAACATTGTGGATGTGAAAGCAGACAACAATTGTGGA
2 dna:chromosome chromosome:Glycine_max_v2.0:2:1:48577505:1 REF
position: 8356198-8356212
GTGGATCAATTTCATCCTGTTATACACGAT8356198TTCATTGACAACATTGTGGATGTCAAAGCTGACGGTAACTGTGGA
3 dna:chromosome chromosome:Glycine_max_v2.0:3:1:45779434:1 REF
position: 2400240-2400254
TTCGATCAATTACATTCATTTATACACAAT2400240TTCATTGACAACATTGTGGATGTCAAAGCTGATAGTAACTGTGGA
3 dna:chromosome chromosome:Glycine_max_v2.0:3:1:45779434:1 REF
position: 11526542-11526556
TTGGATCAATTTCAACCATTTATACACAAT11526542TTCATTGACAACATTGTAGATGCCAAAACTGACAGTAACTGTGGA
4 dna:chromosome chromosome:Glycine_max_v2.0:4:1:52388848:1 REF
position: 6988352-6988366
TTGGATCAATTTCATCCGTTTATACATGAT6988352TTCATTGACAACATTGTGGATGCCAAAGCTGACGGTAACTGTGGA
4 dna:chromosome chromosome:Glycine_max_v2.0:4:1:52388848:1 REF
position: 8305503-8305517
TTGGATCAATTTCATCCGTTTATACATGAT8305503TTCATTGACAACATTGTGGATGTCAAAGCTGACGGTAACTGTGGA
4 dna:chromosome chromosome:Glycine_max_v2.0:4:1:52388848:1 REF
position: 11353738-11353752
TCATTCCAAAATTGAAAACATTTAAGGAAG11353738TTCATTGACAACATTTGATGAAGTGGCAACATGTGAAACAAACAT
4 dna:chromosome chromosome:Glycine_max_v2.0:4:1:52388848:1 REF
position: 22858846-22858860
TTGGATCAATTTCATTTGTTTATACATGAT22858846TTCATTGACAACATTGTGGATGTCAAAGCTGACGATAACTGTGGA
4 dna:chromosome chromosome:Glycine_max_v2.0:4:1:52388848:1 REF
position: 36052810-36052824
TTGGATCAATTTCAGCCATTTATACACGAC36052810TTCATTGACAACATTATGGATGTCAAAGCTTATAGTAACTGTGGA
6 dna:chromosome chromosome:Glycine_max_v2.0:6:1:51416163:1 REF
position: 18260519-18260533
TTAGATCAATTTTAGCCATTTATACACGAT18260519TTCATTGACAACATTGTGGATGTCAAAGCTGACGGTAACTGTGGA
6 dna:chromosome chromosome:Glycine_max_v2.0:6:1:51416163:1 REF
position: 20887362-20887376
TTAGATCAATTTGAGCCATTTATACAGGGT20887362TTCATTGACAACATTGTGGATGTGGTAGCGGACGGTAACTGTGGA
7 dna:chromosome chromosome:Glycine_max_v2.0:7:1:44630203:1 REF
position: 28728636-28728650
TTGGATCAATTTCAGCCATTTATACACGAT28728636TTCATTGACAACATTGTGGATGTCAAAGCTGACAGTAACTTTTTA
7 dna:chromosome chromosome:Glycine_max_v2.0:7:1:44630203:1 REF
position: 31539063-31539077
TTGGATTAATTTGAGCCATTTATACAGGGT31539063TTCATTGACAACATTGTGGATGTGAAAGCAGATGATAACTGTAGA
8 dna:chromosome chromosome:Glycine_max_v2.0:8:1:47837022:1 REF
position: 30784861-30784875
TTGGATCAATTTTAGTCGTTTATACACGAT30784861TTCATTGACAACATTGTGGATGTCAAAGCTGAAGGTAACCATGGA
8 dna:chromosome chromosome:Glycine_max_v2.0:8:1:47837022:1 REF
position: 33369784-33369798
TTGGATCAGTTTCATCCATTTATACACGAT33369784TTCATTGACAACATTGTGGATGTCAAAGTTGACGGTAACTGTAAA
10 dna:chromosome chromosome:Glycine_max_v2.0:10:1:51566898:1 REF
position: 34099820-34099834
TTGGATCAATTTCAGCCATTTATACACGAT34099820TTCATTGACAACATTGTGGATGTCAAAGCTGACGGTAACTGTGGA
10 dna:chromosome chromosome:Glycine_max_v2.0:10:1:51566898:1 REF
position: 39867646-39867660
TTGGATCAATTTCATCTGTTTATACACGAT39867646TTCATTGACAACATTGTGGATGTCAAAGCTAACGGTAACTGTGGA
12 dna:chromosome chromosome:Glycine_max_v2.0:12:1:40091314:1 REF
position: 12844569-12844583
TTGGATCAATTTGAGCCATTTATACAGGGT12844569TTCATTGACAACATTGTGGATGTGAAAGCGGACGGTAATTGAAGA
12 dna:chromosome chromosome:Glycine_max_v2.0:12:1:40091314:1 REF
position: 36911425-36911439
AGGAAGAGTGTAAGGGAAGGAAAAAATAAA36911425TTCATTGACAACATTTTTCTAGTTTGAGTACCCTGTTTAGTAAAG
13 dna:chromosome chromosome:Glycine_max_v2.0:13:1:45874162:1 REF
position: 10798744-10798758
TTGGATCAATTTCAGCCATTTATCCACGAC10798744TTCATTGACAACATTATTGATGTCAAAGCTGATAAAAACTGTGGA
13 dna:chromosome chromosome:Glycine_max_v2.0:13:1:45874162:1 REF
position: 13318076-13318090
TTGGATCAATTTCAGCGATTTTTCCACGAC13318076TTCATTGACAACATTGTGGATGTCAAAGCTGATGGAAACTGTGGA
14 dna:chromosome chromosome:Glycine_max_v2.0:14:1:49042192:1 REF
position: 42247076-42247090
TTGGATCAATTTGAACCATTTATACAGGGT42247076TTCATTGACAACATTGTGGATGTGAAAGCGGACGGTAATTGTGGA
16 dna:chromosome chromosome:Glycine_max_v2.0:16:1:37887014:1 REF
position: 14528752-14528766
TTGGATCAATTTCAGTCATTTATCCACGAC14528752TTCATTGACAACATTGTGGATGTCAAAGCTGACGGAAACTGTGGA
16 dna:chromosome chromosome:Glycine_max_v2.0:16:1:37887014:1 REF
position: 14816284-14816298
TTGGATCAATTTCAACCGTTTATACACGAT14816284TTCATTGACAACATTGTGGATGTCAAAGCTGACGATAACTGTGGA
18 dna:chromosome chromosome:Glycine_max_v2.0:18:1:58018742:1 REF
position: 17033260-17033274
TTTTAGCTCACTAACTATTGAATTTCTCAG17033260TTCATTGACAACATTTGTCCTATCAAGTCATTCTATCAAACTTAA
18 dna:chromosome chromosome:Glycine_max_v2.0:18:1:58018742:1 REF
position: 47313598-47313612
AACAATAATAGGAGTACAACTAAGTCAAAA47313598TTCATTGACAACATTCTAGTTGTTGAGGAAAGAGTTCAGAATAGG
19 dna:chromosome chromosome:Glycine_max_v2.0:19:1:50746504:1 REF
position: 24137005-24137019
TTGGATTAATTTGAGCCATTTATACAGGGT24137005TTCATTGACAACATTGTGGATGTGAAAGCGGATGGTAATTGTGGA
19 dna:chromosome chromosome:Glycine_max_v2.0:19:1:50746504:1 REF
position: 33688240-33688254
TTGGATCAATTTGAGCCATTTATACAAGGT33688240TTCATTGACAACATTGTGGATGTGAAAGCTAACGGTAACTGTGGA
19 dna:chromosome chromosome:Glycine_max_v2.0:19:1:50746504:1 REF
position: 35872017-35872031
TTGGATCAATTTCAGCCATTTATCCACGAT35872017TTCATTGACAACATTGTCAATGTCAAAGCTGACGAAAACTGTGGA
1 dna:chromosome chromosome:Glycine_max_v2.0:1:1:56831395:1 REF
position: 6345964-6345978
TTCACAATTACCGTCAGCTTTCACATTCAC6345964AATGTTGTCAATGAAACCCTGTATAAATGGCTCAAATTGATCCAA
1 dna:chromosome chromosome:Glycine_max_v2.0:1:1:56831395:1 REF
position: 8007766-8007780
TCCATAGTTTCCGTCAGCTTTGACATCCAC8007766AATGTTGTCAATGAAATCGTGGATAAATGGCTGAATTGATCCAAC
1 dna:chromosome chromosome:Glycine_max_v2.0:1:1:56831395:1 REF
position: 14751986-14752000
TCCACAGTTATTGTCAGCTTTGACATCCAC14751986AATGTTGTCAATGAAATCATGTATAAATGGATGAAATTGATCCAA
1 dna:chromosome chromosome:Glycine_max_v2.0:1:1:56831395:1 REF
position: 43047397-43047411
TCCATAGTTTCCGTCAGGTTTGACATCCAC43047397AATGTTGTCAATGAAATCTTGCATAAATGGCTGAAATTGATCCAA
2 dna:chromosome chromosome:Glycine_max_v2.0:2:1:48577505:1 REF
position: 23914118-23914132
TCCATAGTTACCATATGCTTTCACATCCAC23914118AATGTTGTCAATGAAATCCTGTATAAATGGCTCAAATTGATGCAC
3 dna:chromosome chromosome:Glycine_max_v2.0:3:1:45779434:1 REF
position: 23174134-23174148
CCCACAGTTTCTGTTAGCTTTGACATCGAC23174134AATGTTGTCAATGAAATCGTGGATAAATGGCTAAAATTGATCCAA
4 dna:chromosome chromosome:Glycine_max_v2.0:4:1:52388848:1 REF
position: 8282839-8282853
TCCATAGTTACCATCCGCTTTCACATCCAT8282839AATGTTGTCAATGAAATCCTGTATAAATTGCTCAAATTGATCCAA
4 dna:chromosome chromosome:Glycine_max_v2.0:4:1:52388848:1 REF
position: 9940906-9940920
TCCATAGTTTCCGTCAGGTTTGACATCCAC9940906AATGTTGTCAATGAAATCCTGCATAAATGGCTGAAATTGATCCAA
4 dna:chromosome chromosome:Glycine_max_v2.0:4:1:52388848:1 REF
position: 14303116-14303130
TTTTTTACAACATCGATTTTACAAAACATC14303116AATGTTGTCAATGAAGAACAACATTGGTTTTTATTAAAACCGATG
4 dna:chromosome chromosome:Glycine_max_v2.0:4:1:52388848:1 REF
position: 20936724-20936738
GCTGGGGTAGATGGCAAACGTTGTCTGGAA20936724AATGTTGTCAATGAAGTTGTGTTGCTTGCTGCTCGTAGAGGTAAC
4 dna:chromosome chromosome:Glycine_max_v2.0:4:1:52388848:1 REF
position: 46341968-46341982
TCCACAGTTACCGTCAACTTTGACATCCAC46341968AATGTTGTCAATGAAATCGTGTATAAACGGCTGAAATTGATCCAA
5 dna:chromosome chromosome:Glycine_max_v2.0:5:1:42234498:1 REF
position: 20031250-20031264
CCCATAGTTTCCATCAGCTTGGACATCAAT20031250AATGTTGTCAATGAAGTCGTGGATAAATGGCTGAAATTGATCCAA
7 dna:chromosome chromosome:Glycine_max_v2.0:7:1:44630203:1 REF
position: 14680386-14680400
TCCACAGTTATCATCCGCTTTCACATCCAC14680386AATGTTGTCAATGAAACCCTATATAAATGGCTCAAATTGATCCAA
7 dna:chromosome chromosome:Glycine_max_v2.0:7:1:44630203:1 REF
position: 15137667-15137681
TCCACAGTTACTGTCAGCTTTCACATCCAC15137667AATGTTGTCAATGAAATCCTATATAAATGGCTCAAATTGATCCAA
7 dna:chromosome chromosome:Glycine_max_v2.0:7:1:44630203:1 REF
position: 18317304-18317318
TTGAGTTTGAGACAATGATTGGGTAAGCCA18317304AATGTTGTCAATGAATTAAGAAATTCAGTTGTGAGTGAGCGAAAA
7 dna:chromosome chromosome:Glycine_max_v2.0:7:1:44630203:1 REF
position: 26359051-26359065
TCCACAGTTACCGTCAGCTTTCACATCCAC26359051AATGTTGTCAATGAAACCCTGTATATAAATGGCTTAAATTGATCC
7 dna:chromosome chromosome:Glycine_max_v2.0:7:1:44630203:1 REF
position: 39594950-39594964
TCCACAGTTTCCATCAACTTTGACATCCAC39594950AATGTTGTCAATGAAGTCGTGGATAAATGACTGAAATTGATCCAA
8 dna:chromosome chromosome:Glycine_max_v2.0:8:1:47837022:1 REF
position: 19255411-19255425
TCCACAGTTACCATCCGCTTTCACATCCAC19255411AATGTTGTCAATGAAACCTTGTATAAATGACTCAAATTGATCCAA
8 dna:chromosome chromosome:Glycine_max_v2.0:8:1:47837022:1 REF
position: 19373649-19373663
TCCATAGTTACCGTCAGCTTTGACATCCAC19373649AATGTTGTCAATGAAATCGTGGATAAATGGTTGAAATTGATCCAA
8 dna:chromosome chromosome:Glycine_max_v2.0:8:1:47837022:1 REF
position: 36735706-36735720
TCCATAGTTACCGTCAGCTTTGACATCCAC36735706AATGTTGTCAATGAACTATGCTTCATCGAAGAATTACTATTTTGC
10 dna:chromosome chromosome:Glycine_max_v2.0:10:1:51566898:1 REF
position: 8725914-8725928
TCCACAGTTACCATTCGCTTTAACATCCAC8725914AATGTTGTCAATGAAACCCTGTATAAATGGCTCAAATTGATCCAA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Soybn_V2.0/TTCATTGACAACATT
lang : en | db : Soybn_V2.0 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.082 | 0.075 | search_plus_done; http://172.18.8.75:28176/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.104 | 0.022 | search_minus_done; http://172.18.8.75:28176/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=21
0.117 | 0.012 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).