GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-04 11:46:45, GGGenome : S. purpuratus genome, Spur_v3.1 (Jun, 2011)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Scaffold44
position: 134057-134071
ACTGATACACTGCTTGCTTCCCACTCTGAA134057TTCATTGACAACATTGGTGTCCAATGTACTACCACTAGTCTTGTA
Scaffold158
position: 179393-179407
AGTTTTATATTGACATAGTGTCCATTACGC179393TTCATTGACAACATTGACTTGACTACGGCATCCTTAACACACATG
Scaffold284
position: 32153-32167
CTTCCAAGGCCCTGCTGTGCATGTTCACTG32153TTCATTGACAACATTTGTGTAAAATTTGAACGAGCAGACAACCCG
Scaffold284
position: 32622-32636
CTTCCAAGGCCCTGCTGTGCATGTTCACTG32622TTCATTGACAACATTTGTGTAAAATTTGAACGAGCAGACAACCCG
Scaffold522
position: 28007-28021
CATATCAAGGTTATTATTAAAAAGCCTCTT28007TTCATTGACAACATTTGAAAAGAAAAGAAAAATCCAAAAACCTCT
Scaffold876
position: 355967-355981
AGGTAAGATTACTTCACTTCATTTCATGTT355967TTCATTGACAACATTTTTTTCATCGATGACAAACGCAGTAGGTCT
Scaffold1109
position: 138503-138517
TAATACATTCTTGGCTCACAGATGTCCCTT138503TTCATTGACAACATTGTTGTTAATGTTCCGATAGGAAGCTATGTT
Scaffold1539
position: 123329-123343
TTTGTAATTGTTCATATCTTATATCTCACT123329TTCATTGACAACATTCTATAAAACCTCAATGTTCAAACACAATAA
Scaffold2357
position: 85989-86003
AGTTTTATTTTGACATAGTGTCCATTACGC85989TTCATTGACAACATTGACACGACTACAGCATCCTTAACCCTATTT
Scaffold2357
position: 96586-96600
AGTTTTATTTTGACATAGTGTTCATTACGC96586TTCATTGACAACATTGACATGACTACAGCATCCTTAACACACGTG
Scaffold108
position: 15013-15027
AAAGGATGCATCTTTTATCACACTTTCTAT15013AATGTTGTCAATGAAAGCACAATCCTGCTCGGTTCAGGCAAAAAT
Scaffold130
position: 59289-59303
TCAATAGTGAGAAACTGTCGAAAACTCTAA59289AATGTTGTCAATGAAGATAATAGAAATATGAATGCATGTTGTGGA
Scaffold210
position: 414468-414482
TGTATTCCCAATGTTTAAGGTCGTAGAGTC414468AATGTTGTCAATGAAAATCACAAGTCAAAACTCAACCATACCTCG
Scaffold905
position: 79127-79141
ATATCGTCAATTTTTCGTGTCCTGGACTTG79127AATGTTGTCAATGAAAAATTCCCTATAAACAGGTTTCCCATTTTT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Spur_v3.1/TTCATTGACAACATT
lang : en | db : Spur_v3.1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.077 | 0.071 | search_plus_done; http://172.18.8.77:28232/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.087 | 0.009 | search_minus_done; http://172.18.8.77:28232/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=40
0.089 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).