GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2024-04-25 07:15:06, GGGenome : Rabbit pre-spliced RNA, RefSeq on UM_NZW_1.0chr, D3G 23.02 (Feb, 2023)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

XM_051847092.1|C1H9orf153;100342003|chr1:86246548:86253126:-|prespliced::chr1:86246548-86253126(-)
position: 5810-5824
AGAAACACATTGGGAATCTTGGAAGTGGAA5810AATGTTGTCAATGAAACCAAGAACCTTCCAAAATTATCCCAATTA
XM_008257491.3|C1H9orf153;100342003|chr1:86246548:86273702:-|prespliced::chr1:86246548-86273702(-)
position: 26386-26400
AGAAACACATTGGGAATCTTGGAAGTGGAA26386AATGTTGTCAATGAAACCAAGAACCTTCCAAAATTATCCCAATTA
XM_051847101.1|C1H9orf153;100342003|chr1:86246548:86273702:-|prespliced::chr1:86246548-86273702(-)
position: 26386-26400
AGAAACACATTGGGAATCTTGGAAGTGGAA26386AATGTTGTCAATGAAACCAAGAACCTTCCAAAATTATCCCAATTA
XM_008257487.3|C1H9orf153;100342003|chr1:86246548:86276381:-|prespliced::chr1:86246548-86276381(-)
position: 29065-29079
AGAAACACATTGGGAATCTTGGAAGTGGAA29065AATGTTGTCAATGAAACCAAGAACCTTCCAAAATTATCCCAATTA
XM_051847112.1|C1H9orf153;100342003|chr1:86246548:86276382:-|prespliced::chr1:86246548-86276382(-)
position: 29066-29080
AGAAACACATTGGGAATCTTGGAAGTGGAA29066AATGTTGTCAATGAAACCAAGAACCTTCCAAAATTATCCCAATTA
XM_008257472.3|C1H9orf153;100342003|chr1:86246548:86287979:-|prespliced::chr1:86246548-86287979(-)
position: 40663-40677
AGAAACACATTGGGAATCTTGGAAGTGGAA40663AATGTTGTCAATGAAACCAAGAACCTTCCAAAATTATCCCAATTA
XM_051854304.1|LOC100340498;100340498|chr12:28690181:28936512:+|prespliced::chr12:28690181-28936512(+)
position: 174126-174140
CTGTAAAAATGGCTTGAAGATTGTTTAGTC174126AATGTTGTCAATGAAAAAAAAATGGCTTCTGTAATCAAGCTTAAT
XM_017349189.2|LOC100356654;100356654|chr19:38697358:38714878:+|prespliced::chr19:38697358-38714878(+)
position: 5247-5261
TCTCCTTTATCTTTTACAAGTTTATAGTAA5247AATGTTGTCAATGAAATCATACAATGACTGGATTTGCTCAGAAAT
XM_051825651.1|LOC100356654;100356654|chr19:38697358:38714878:+|prespliced::chr19:38697358-38714878(+)
position: 5247-5261
TCTCCTTTATCTTTTACAAGTTTATAGTAA5247AATGTTGTCAATGAAATCATACAATGACTGGATTTGCTCAGAAAT
XM_051850472.1|LOC100357836;100357836|chr8:9636919:10046910:-|prespliced::chr8:9636919-10046910(-)
position: 2812-2826
TCATTAGCATAATAGGTTTCAGAAAAGGTT2812TTCATTGACAACATTAGTGATAGTCAAGATATGTGTATTGCCTGT
XM_008260152.3|LOC100357836;100357836|chr8:9636919:10068464:-|prespliced::chr8:9636919-10068464(-)
position: 24366-24380
TCATTAGCATAATAGGTTTCAGAAAAGGTT24366TTCATTGACAACATTAGTGATAGTCAAGATATGTGTATTGCCTGT
XM_051850465.1|LOC100357836;100357836|chr8:9636919:10068464:-|prespliced::chr8:9636919-10068464(-)
position: 24366-24380
TCATTAGCATAATAGGTTTCAGAAAAGGTT24366TTCATTGACAACATTAGTGATAGTCAAGATATGTGTATTGCCTGT
XM_051850466.1|LOC100357836;100357836|chr8:9636919:10068464:-|prespliced::chr8:9636919-10068464(-)
position: 24366-24380
TCATTAGCATAATAGGTTTCAGAAAAGGTT24366TTCATTGACAACATTAGTGATAGTCAAGATATGTGTATTGCCTGT
XM_051850468.1|LOC100357836;100357836|chr8:9636919:10068464:-|prespliced::chr8:9636919-10068464(-)
position: 24366-24380
TCATTAGCATAATAGGTTTCAGAAAAGGTT24366TTCATTGACAACATTAGTGATAGTCAAGATATGTGTATTGCCTGT
XM_051850469.1|LOC100357836;100357836|chr8:9636919:10068464:-|prespliced::chr8:9636919-10068464(-)
position: 24366-24380
TCATTAGCATAATAGGTTTCAGAAAAGGTT24366TTCATTGACAACATTAGTGATAGTCAAGATATGTGTATTGCCTGT
XM_051850470.1|LOC100357836;100357836|chr8:9636919:10068464:-|prespliced::chr8:9636919-10068464(-)
position: 24366-24380
TCATTAGCATAATAGGTTTCAGAAAAGGTT24366TTCATTGACAACATTAGTGATAGTCAAGATATGTGTATTGCCTGT
XM_051850471.1|LOC100357836;100357836|chr8:9699885:10068464:-|prespliced::chr8:9699885-10068464(-)
position: 24366-24380
TCATTAGCATAATAGGTTTCAGAAAAGGTT24366TTCATTGACAACATTAGTGATAGTCAAGATATGTGTATTGCCTGT
XM_051850473.1|LOC100357836;100357836|chr8:9699885:10068464:-|prespliced::chr8:9699885-10068464(-)
position: 24366-24380
TCATTAGCATAATAGGTTTCAGAAAAGGTT24366TTCATTGACAACATTAGTGATAGTCAAGATATGTGTATTGCCTGT
XM_002713403.4|LOC100008708;100008708|chr9:92029629:92032404:+|prespliced::chr9:92029629-92032404(+)
position: 30-44
GAATGCTACACTCCAAATACTATTGTGTT30TTCATTGACAACATTCACTATTACATATGCATATGAACACCAGTC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/UM_NZW_1.0chr_RefSeq_prespliced_d3g2302/AATGTTGTCAATGAA
lang : en | db : UM_NZW_1.0chr_RefSeq_prespliced_d3g2302 | k : 0 | strand : | nogap : | query_string : AATGTTGTCAATGAA | format : html | download : | debug :

0.009 | 0.009 | search_start;
0.084 | 0.075 | search_plus_done; http://172.18.8.78:28954/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.095 | 0.011 | search_minus_done; http://172.18.8.78:28954/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=41
0.103 | 0.007 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).