GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2024-02-28 08:32:23, GGGenome : Rabbit spliced RNA, RefSeq on UM_NZW_1.0chr, D3G 23.02 (Feb, 2023)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

XM_002713403.4|LOC100008708;100008708|chr9:92029629:92032404:+|spliced::chr9:92029629-92032404(+)
position: 30-44
GAATGCTACACTCCAAATACTATTGTGTT30TTCATTGACAACATTCACTATTACATATGCATATGAACACCAGTC
XM_051847092.1|C1H9orf153;100342003|chr1:86246548:86253126:-|spliced::chr1:86246548-86253126(-)
position: 1350-1364
AGAAACACATTGGGAATCTTGGAAGTGGAA1350AATGTTGTCAATGAAACCAAGAACCTTCCAAAATTATCCCAATTA
XM_008257491.3|C1H9orf153;100342003|chr1:86246548:86273702:-|spliced::chr1:86246548-86273702(-)
position: 2241-2255
AGAAACACATTGGGAATCTTGGAAGTGGAA2241AATGTTGTCAATGAAACCAAGAACCTTCCAAAATTATCCCAATTA
XM_051847101.1|C1H9orf153;100342003|chr1:86246548:86273702:-|spliced::chr1:86246548-86273702(-)
position: 2302-2316
AGAAACACATTGGGAATCTTGGAAGTGGAA2302AATGTTGTCAATGAAACCAAGAACCTTCCAAAATTATCCCAATTA
XM_008257487.3|C1H9orf153;100342003|chr1:86246548:86276381:-|spliced::chr1:86246548-86276381(-)
position: 3945-3959
AGAAACACATTGGGAATCTTGGAAGTGGAA3945AATGTTGTCAATGAAACCAAGAACCTTCCAAAATTATCCCAATTA
XM_051847112.1|C1H9orf153;100342003|chr1:86246548:86276382:-|spliced::chr1:86246548-86276382(-)
position: 4007-4021
AGAAACACATTGGGAATCTTGGAAGTGGAA4007AATGTTGTCAATGAAACCAAGAACCTTCCAAAATTATCCCAATTA
XM_008257472.3|C1H9orf153;100342003|chr1:86246548:86287979:-|spliced::chr1:86246548-86287979(-)
position: 1434-1448
AGAAACACATTGGGAATCTTGGAAGTGGAA1434AATGTTGTCAATGAAACCAAGAACCTTCCAAAATTATCCCAATTA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/UM_NZW_1.0chr_RefSeq_spliced_d3g2302/TTCATTGACAACATT
lang : en | db : UM_NZW_1.0chr_RefSeq_spliced_d3g2302 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.079 | 0.071 | search_plus_done; http://172.18.8.78:28955/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.087 | 0.008 | search_minus_done; http://172.18.8.78:28955/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=49
0.091 | 0.004 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).