GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-01 11:24:19, GGGenome : Citrullus lanatus subsp. vulgaris (97103) genome, v1

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Chr3
position: 15482535-15482549
GCAGCATTCCACGACACATTCGTAATAGTC15482535TTCATTGACAACATTTTGGTGTATTCTCGAACCGAGGCTGAGCAC
Chr4
position: 15134174-15134188
AAGCACGAGGACAAAATAAGAAGGAACAAC15134174TTCATTGACAACATTCTTCTGTTTGGTAAGGTTTAACAAACAAGT
Chr6
position: 1630372-1630386
TGAATTACTTCAAACATGACTTAACTTAGT1630372TTCATTGACAACATTAAAATTAACGTACTGCAACAGGGGTGCCAA
Chr6
position: 7268551-7268565
TGAAGAAGATTGTGAGCTGTTGTCTTGAGT7268551TTCATTGACAACATTGAAGACTGTACCACGGAAAGATTGAAAAGA
Chr5
position: 17546968-17546982
AAAAAGTGTTCTTAAAAGGTAACTAAGTCA17546968AATGTTGTCAATGAAAACCATGTAGAAGGTTACTGAAAAGTGTCC
Chr5
position: 29851701-29851715
CACAAGCTTGCTTACCTGGGTAAAACGGAA29851701AATGTTGTCAATGAAGAGAAGCACATCTTGCCCTTCAGCATCACG
Chr0
position: 443548-443562
TCTTTTCAATCTTTCCGTGGTACAGTCTTC443548AATGTTGTCAATGAAACTCAAGACAACAGCTCACAATCTTCTTCA
Chr0
position: 5665596-5665610
CCAAAAATGTTCTAAAAGGTAGCTAAGTCA5665596AATGTTGTCAATGAAAACCATGTAAAAGGCTCATAAAAAGTATCT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/W97103_v1/TTCATTGACAACATT
lang : en | db : W97103_v1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.080 | 0.073 | search_plus_done; http://172.18.8.72:28215/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.085 | 0.006 | search_minus_done; http://172.18.8.72:28215/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=46
0.087 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).