GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-01 11:16:38, GGGenome : Xenopus laevis genome, XenBase/JGI 9.1

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr3L:
3929393-3929407
AGAATCCAGGTTTCATAGCAATTTAACGCT3929393TTCATTGACAACATTCTTTGCTAATCACGTGTAAATTTAATTACA
chr3S:
32678469-32678483
ATTCTCTTTTTCAAAATCTTCAAAGAGAGA32678469TTCATTGACAACATTTATAAGCCACATATAATACTCTTGGTGAGA
chr3S:
40514747-40514761
CATTTAGCAGTCGATGTTTACTACAATCAG40514747TTCATTGACAACATTTCTATTTTTTATAAAGAAACCCCCCCCCAA
chr3S:
77149153-77149167
ACTATATTAGACAAACAAAATGCTACAGTT77149153TTCATTGACAACATTGCATATGTCCTCTGAGGCTTTAGTGTACTG
chr6L:
12865956-12865970
CACCAGCCCCATCACAGGATAACGAACTTC12865956TTCATTGACAACATTCTACGGCCGGAGTTCGGGAGGAGGAAAGAA
chr8L:
20166070-20166084
AGAGCAGAAGGTCTTGGTGGGAAAGCCAAG20166070TTCATTGACAACATTAGGTAAATCATGTTGGGGTAAACTGGAAAC
chr9_10L:
110997352-110997366
GGTTGTAAACGAATTATTGTTTGAAGCAAA110997352TTCATTGACAACATTTTTCTCATGGGACACAGATTCAGAAACACT
chr9_10S:
33719487-33719501
TCAATATGAAATTATAGAAAACAATTAGTC33719487TTCATTGACAACATTGACAACATTGACTTGTCATTCTGTTGCCTA
chr9_10S:
40586527-40586541
CACTTATTGTCTGTTACACATCGGATATGC40586527TTCATTGACAACATTTGGAAATATAAGGCTTGTAATTCATTTTGT
chr2L:
139952531-139952545
CACCTCTGATCCAGCCTGGGTAAACCTGAA139952531AATGTTGTCAATGAAAAGCAACACATCTTGTCCCTCTTGATCTCT
chr2S:
121444512-121444526
CACCTCTGAACCAGCCTGGGTGAACCTGAA121444512AATGTTGTCAATGAAAAGCAACACATCTTGTCCCTCTTGATCTCT
chr3L:
91866746-91866760
TACCCCAAATAGCTATAAACAAGCTTTGTC91866746AATGTTGTCAATGAAAAGCATTTAGCATAACCTACTGACGTGCTC
chr3S:
62731827-62731841
AATTGGGCAGCAAACTGGAAAATGAGGTTC62731827AATGTTGTCAATGAATGCAAGGCAATGCACTTTTGTAGAAATAAT
chr5L:
110622542-110622556
GTAAGTACCTGCATTCAACTCCTTCACACT110622542AATGTTGTCAATGAAAGAACTAGTGTAAACGAACAGGATGTTCTA
chr6S:
43465863-43465877
AGAAATCATCCTGCCAAATATTTTAAAGAC43465863AATGTTGTCAATGAAAAGCCCAAGCTGCGGTGCGGGAAAGCGACC
chr6S:
99975036-99975050
CTTTCATGGTAAAAGTATGGAGCAATATTC99975036AATGTTGTCAATGAAAGGTCAGGCCATTTGCATTCATTAGCAGCC
chr9_10L:
24826124-24826138
AATAAGGATATGCGAATGGAAATGGTGCAA24826124AATGTTGTCAATGAACTCTTTAACCTATTGTTCAAAAAATAGGCA
chr9_10L:
108237892-108237906
ATGTACACACAAAGGCAACAAAGGCAATTG108237892AATGTTGTCAATGAAAGCAAAAGCGGTCTTAGCTGCCCGCAGGTG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Xenla9/TTCATTGACAACATT
lang : en | db : Xenla9 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.079 | 0.072 | search_plus_done; http://172.18.8.77:28228/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.087 | 0.008 | search_minus_done; http://172.18.8.77:28228/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=41
0.091 | 0.004 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).