GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-01 02:17:03, GGGenome : Xenopus tropicalis genome, XenBase/JGI 7.1

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

scaffold_1:
179364307-179364321
ATAGGGTTCAGTTATGACTGCAACTGTGCG179364307TTCATTGACAACATTTATCCAGGTTTCTTCTGTGCAAATCGCTCC
scaffold_2:
108736489-108736503
AGGGAGTGGTGTGTGGAACTGGTATTCCAG108736489TTCATTGACAACATTACCTTGAAATAAATGGGGTTTGGAGGCAGA
scaffold_7:
76181911-76181925
ACGGGCATCTGAAAATGTGAAAATACCACA76181911TTCATTGACAACATTGTATTGAGAAGTTTATAAAATAATGTGAAG
scaffold_45:
419397-419411
CACTCTCACAATATTCAATATTTTGGTTGC419397TTCATTGACAACATTATTCTTATATGGTCCGGTACCGATGAACAA
scaffold_4:
66453287-66453301
CCAATAGCTTTGGGAATGAGCAGTGTAAGC66453287AATGTTGTCAATGAAACAAAATTATACAGGCCAATAACTTATTAT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Xentr7/TTCATTGACAACATT
lang : en | db : Xentr7 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.085 | 0.078 | search_plus_done; http://172.18.8.77:28225/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.095 | 0.010 | search_minus_done; http://172.18.8.77:28225/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=46
0.096 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).