GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-12-01 11:36:24, GGGenome : Xenopus tropicalis genome, XenBase/JGI 8.0

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Chr01:
154015828-154015842
ATAGGGTTCAGTTATGACTGCAACTGTGCG154015828TTCATTGACAACATTTATCCAGGTTTCTTCTGTGCAAATCGCTCC
Chr02:
149270438-149270452
AGGGAGTGGTGTGTGGAACTGGTATTCCAG149270438TTCATTGACAACATTACCTTGAAATAAATGGGGTTTGGAGGCAGA
Chr07:
67222791-67222805
ACGGGCATCTGAAAATGTGAAAATACCACA67222791TTCATTGACAACATTGTATTGAGAAGTTTATAAAATAATGTGAAG
scaffold_61:
419397-419411
CACTCTCACAATATTCAATATTTTGGTTGC419397TTCATTGACAACATTATTCTTATATGGTCCGGTACCGATGAACAA
Chr04:
96548353-96548367
CCAATAGCTTTGGGAATGAGCAGTGTAAGC96548353AATGTTGTCAATGAAACAAAATTATACAGGCCAATAACTTATTAT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Xentr8/TTCATTGACAACATT
lang : en | db : Xentr8 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.100 | 0.092 | search_plus_done; http://172.18.8.77:28226/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.106 | 0.006 | search_minus_done; http://172.18.8.77:28226/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=46
0.106 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).