GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2022-12-06 10:01:56, GGGenome : Xenopus tropicalis genome, XenBase/JGI 9.0

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Chr02:
154760750-154760764
AGGGAGTGGTGTGTGGAACTGGTATTCCAG154760750TTCATTGACAACATTACCTTGAAATAAATGGGGTTTGGAGGCAGA
Chr07:
82563692-82563706
ACGGGCATCTGAAAATGTGAAAATACCACA82563692TTCATTGACAACATTGTATTGAGAAGTTTATAAAATAATGTGAAG
scaffold_61:
415813-415827
CACTCTCACAATATTCAATATTTTGGTTGC415813TTCATTGACAACATTATTCTTATATGGTCCGGTACCGATGAACAA
Chr01:
35421815-35421829
GGAGCGATTTGCACAGAAGAAACCTGGATA35421815AATGTTGTCAATGAACGCACAGTTGCAGTCATAACTGAACCCTAT
Chr04:
93421564-93421578
CCAATAGCTTTGGGAATGAGCAGTGTAAGC93421564AATGTTGTCAATGAAACAAAATTATACAGGCCAATAACTTATTAT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Xentr9/TTCATTGACAACATT
lang : en | db : Xentr9 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.085 | 0.076 | search_plus_done; http://172.18.8.77:28227/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.090 | 0.005 | search_minus_done; http://172.18.8.77:28227/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=47
0.092 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).