GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-01 11:36:08, GGGenome : Platyfish genome, Xipmac4.4.2 (Jan, 2012)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

JH556663.1 dna:scaffold scaffold:Xipmac4.4.2:JH556663.1:1:7384412:1 REF
position: 6072838-6072852
AGCTACTAAATAATGGGGTGTCCTTAGTTT6072838TTCATTGACAACATTTCCCTTTTTGTGGTACCCGTATTAAATGTG
JH557242.1 dna:scaffold scaffold:Xipmac4.4.2:JH557242.1:1:177806:1 REF
position: 162817-162831
GGCCCACAGAACCACAGAACAACAAACTTC162817TTCATTGACAACATTTTACGGCCGGATTTCGGATGCAAGAGGGAA
JH556673.1 dna:scaffold scaffold:Xipmac4.4.2:JH556673.1:1:4361753:1 REF
position: 444697-444711
TTAAAGTCATTAGTGACTTCAGGTTAACAC444697AATGTTGTCAATGAATAACAACAATAAGGGAAATTATGGTACAGT
JH556677.1 dna:scaffold scaffold:Xipmac4.4.2:JH556677.1:1:3631609:1 REF
position: 1320846-1320860
GTATGTTTGTTAGATTTAAAATGGCTTCAG1320846AATGTTGTCAATGAAAGCAAGTCAAAAATAATTTATCATTTTAGT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Xipmac4.4.2/TTCATTGACAACATT
lang : en | db : Xipmac4.4.2 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.078 | 0.071 | search_plus_done; http://172.18.8.76:28126/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.082 | 0.005 | search_minus_done; http://172.18.8.76:28126/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=48
0.083 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).