GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-04 11:29:27, GGGenome : Capsicum annuum (Zunla-1) genome, release 2.0

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Chr00 2012-12-18 BGI
position: 167238201-167238215
TCGTCTATATGTAGCCCAACATGAAAGATA167238201TTCATTGACAACATTGCTCTTCACTTAAGAATCTGAAAAAATCAC
Chr00 2012-12-18 BGI
position: 267784927-267784941
CGACTAGGCCCTGGTTTGGGTTGTGTCAAA267784927TTCATTGACAACATTAATGAGAGCATGTATTCTTTTGATAAGTTC
Chr00 2012-12-18 BGI
position: 291078021-291078035
GCATCATTTTTTCATTTGTCTGTCATTATG291078021TTCATTGACAACATTTTTGTATACTCTAAGAGTGAGGTAGATCAT
Chr00 2012-12-18 BGI
position: 377158712-377158726
CGACTAGGCCCTGGTTTGGGTTGTGTCAAA377158712TTCATTGACAACATTAATGAGAGCATGTATTCTTTTGATAAGTTC
Chr00 2012-12-18 BGI
position: 456261002-456261016
AGGTAATATTTGTATCGCTTCATTATCATG456261002TTCATTGACAACATTCTTGTGTATTCAAGATTAGGGTGGAACATG
Chr00 2012-12-18 BGI
position: 644581449-644581463
TAGCTTTATCTTGATTTATTTGTGATTATG644581449TTCATTGACAACATTTTGGTGTATTCTAAGAGCGAGGTGGATTAT
Chr00 2012-12-18 BGI
position: 712103475-712103489
AGGCCTTATTGGTATTATTTTATGATTGTG712103475TTCATTGACAACATTCTTGTGCATTCGAGGAGTAGAGTGGAGTTT
Chr01 2012-12-18 BGI
position: 269322490-269322504
TCTTTTGATTTTTTACCCCATCTTATTTAG269322490TTCATTGACAACATTATGGTGGGAGTATTTTATGCACAACTTGGA
Chr03 2012-12-18 BGI
position: 34317738-34317752
AATGTCTTGTCATCCTTATTTACTCGTATT34317738TTCATTGACAACATTGAGATTTTATAGTTGGAATGTGGTCAGAAA
Chr04 2012-12-18 BGI
position: 71991393-71991407
TTTAATTGATATTGATAACGACTTATTGAT71991393TTCATTGACAACATTACTCATTCATCACTCCTGATTATCTATATA
Chr04 2012-12-18 BGI
position: 124424171-124424185
ATGCTGTATTTGGACTCCTTCTTGATAGTG124424171TTCATTGACAACATTCTTGTTTATACATAGAGTGGGAAGGAGTAT
Chr05 2012-12-18 BGI
position: 26977453-26977467
CGCAAGGTTTTGAATCTATTTGTCATAGTT26977453TTCATTGACAACATTTTTGTTCACTCTAAGAGCAAGGAGGATCAT
Chr05 2012-12-18 BGI
position: 157338887-157338901
CATCAGTTTTTAGATTTGTTTTTCATCATT157338887TTCATTGACAACATTTTGATTTCTTCTAATAATAAGGAGGATCAT
Chr06 2012-12-18 BGI
position: 11719427-11719441
AGACAATTTAGAAACAAGAGCTAGAGGCAT11719427TTCATTGACAACATTTTCTTTCCAAAATTTGAGCTGATTAGAACC
Chr06 2012-12-18 BGI
position: 75123906-75123920
AAGAAGTACTTGGACATGTTCATCATATTC75123906TTCATTGACAACATTCTTATCTATTCCCGTAATGAAAATGATCAT
Chr06 2012-12-18 BGI
position: 105999910-105999924
CAAAGTGTTGCTGATATTTAAAGCGGAAAA105999910TTCATTGACAACATTAATTTTTGAATAAAGTTACCTTGCTCATGT
Chr07 2012-12-18 BGI
position: 84208131-84208145
TCGTCTATATGTAGCCCAACATGAAAGATA84208131TTCATTGACAACATTGCTCTTCACTTAAGAATCTGAAAAAATCAC
Chr09 2012-12-18 BGI
position: 47417851-47417865
ATTAATTCAAGATCCTTATCATGTTGTAAT47417851TTCATTGACAACATTATAAGTAAAAATATTTTCAACGATTATATC
Chr11 2012-12-18 BGI
position: 22461440-22461454
AAGAAATACTTGGATATGTTCATCATAGTC22461440TTCATTGACAACATTCTTGTCTACTCCCACAGTGAACATGATCAT
Chr11 2012-12-18 BGI
position: 76235812-76235826
TCTTACATAGTTATCCTAACACCAAACATA76235812TTCATTGACAACATTGCCCCTCACTTAAGAAGCTGAAAAGTCACT
Chr12 2012-12-18 BGI
position: 72809403-72809417
AGGTCTTATTTGGATTCCTTTATTATTGTG72809403TTCATTGACAACATTGCTTTGTATTTGAGGAGTGGAGAGAAGTAT
Chr00 2012-12-18 BGI
position: 227916625-227916639
GTGATTTTTTCAGATTCTTAAGTGAAGAGC227916625AATGTTGTCAATGAATATCTTTCATGTTGGGCTACATATAGACGA
Chr00 2012-12-18 BGI
position: 682056881-682056895
GTGCCCTTTCCTACTCCTCGAATATACTGG682056881AATGTTGTCAATGAACACTAACATGAAGGAGTCAAAATAAAACCT
Chr03 2012-12-18 BGI
position: 111436209-111436223
AGAACTTGTAGTTTAGGAAAGGCCTGAAAT111436209AATGTTGTCAATGAAAATGCATATTTGTGTATGAATATTAAGGTT
Chr04 2012-12-18 BGI
position: 120104511-120104525
ACTCTCGTCCCTACTCTTTGAGTACACAGG120104511AATGTTGTCAATGAAAAAAATCATGAAGGAGTCCAAATAAGGCTT
Chr04 2012-12-18 BGI
position: 139618631-139618645
ATTATTATAAGGTCTGAGCGCTTCCTAAAT139618631AATGTTGTCAATGAATGGCTTGAACTACTTTGCCTATGCATTCAG
Chr05 2012-12-18 BGI
position: 5919326-5919340
ATGATCCTCCTCACTCTTAGAATAAATCAA5919326AATGTTGTCAATGAAAACTATGACAAACAGATCTAGAAACTGATG
Chr05 2012-12-18 BGI
position: 83450706-83450720
ATGATCATTTTCACTATGGGAGTAGAAAAT83450706AATGTTGTCAATGAATACTATGATGAACATGTCTACGTACTTCTT
Chr05 2012-12-18 BGI
position: 95907359-95907373
ATGATCCTCACTACTCTTATAATTCATAAG95907359AATGTTGTCAATGAACACAATCACAAAAGAGGCTAAACAAGTCCT
Chr05 2012-12-18 BGI
position: 106367898-106367912
AGTGATTTTTAAGCCTCTTAAGTAAGGGGC106367898AATGTTGTCAATGAATGTATTTCGTTTTGGGATACCTATGGATGA
Chr06 2012-12-18 BGI
position: 16532992-16533006
ATAAATAGCGGAAAAGAGCAGGCTCTGATC16532992AATGTTGTCAATGAATTGCTTTACAGCTAAGTTCTCTCATATCAA
Chr06 2012-12-18 BGI
position: 119920112-119920126
ATGCTCCTGCATACTCCTCTAATACATAAG119920112AATGTTGTCAATGAACACATTTATAATGGAGTCCAAATAGGGTTT
Chr06 2012-12-18 BGI
position: 204958462-204958476
ATGATCCTCCCCAGTCTTAGAATAAATCAA204958462AATGTTGTCAATGAAAATTGTGACAAACAAATCTAGAAACTGATA
Chr06 2012-12-18 BGI
position: 207128533-207128547
CTAAAGGTATTAGGGTGTCTATGTAATGCT207128533AATGTTGTCAATGAATCAGACAAGCTAATGCCTAGATCTTTGAAG
Chr07 2012-12-18 BGI
position: 1320745-1320759
GTTTAGATATGCAGTAGAAAAGGTAAAATC1320745AATGTTGTCAATGAAGTGGAATTGATGACCAATGATGATAGTTTA
Chr07 2012-12-18 BGI
position: 171058476-171058490
TACATGGGCCATCACTAATGATCTTAAAAC171058476AATGTTGTCAATGAAATTCTATACTTTGTATAACTTTTGAGCTAG
Chr08 2012-12-18 BGI
position: 9573299-9573313
ATGATCCTCTCTACTCCTCGAATATAATAG9573299AATGTTGTCAATGAACACAATTATAAAGGAATACAACTAAGGCCT
Chr09 2012-12-18 BGI
position: 58937529-58937543
ATGCTCCTCCCTACTCCTCGAGTACACAAG58937529AATGTTGTCAATGAACACAACCATGGAAGAGTCCAAAAAAGGTCT
Chr09 2012-12-18 BGI
position: 87530369-87530383
GTTCTTATCTCTACTTCTCAAAAACACAAG87530369AATGTTGTCAATGAATAAAATCACAATGGAATAAAAGTAAGGTCT
Chr09 2012-12-18 BGI
position: 120039870-120039884
TTAATATATTGCATATGCTAAACAAACAAA120039870AATGTTGTCAATGAACACAGTCACAAAGTAATCCAAATAAGGCCT
Chr10 2012-12-18 BGI
position: 142662904-142662918
AATGATTTTTTCAGTTTTTAAGAGAGAGAC142662904AATGTTGTCAATGAATATATTTCGTGTTGGGATACCTATGGATGA
Chr11 2012-12-18 BGI
position: 167058722-167058736
GAGCGCTCTATTCTCTGGTGCTCTAATAAT167058722AATGTTGTCAATGAAGTACTATCAGGGGTCTTATTCGTTGTAGGT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/Zunla-1_v2.0/TTCATTGACAACATT
lang : en | db : Zunla-1_v2.0 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.079 | 0.072 | search_plus_done; http://172.18.8.72:28208/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.095 | 0.016 | search_minus_done; http://172.18.8.72:28208/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=29
0.106 | 0.011 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).