GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-01 11:08:02, GGGenome : Lizard genome, Broad AnoCar2.0/anoCar2 (May, 2010)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr1:149949293-149949307
TCTTTGCTTTGCAATGTACACAAACTTTAT149949293TTCATTGACAACATTATTTAAAATATTGTGCATAAAATTACCTTC
chr1:262700235-262700249
AGTTCAAGATTGCAGAAAGGAAGTTGTGCA262700235TTCATTGACAACATTCACATTGTACTTTATGCATATCAGTGTGAA
chr2:20688667-20688681
AACCTAAGTGTACTTTGACATTGAGATGCT20688667TTCATTGACAACATTTAAGCATTCCTGTCCTAGATCAAGCAAGAA
chr3:166036616-166036630
GTGCATATGTGAATACTCTCACACAAAGAT166036616TTCATTGACAACATTCATATTCTGGAGCCCCCAGTGGTGCAGTGA
chr5:13337424-13337438
TACAACATTGACTGGATCTTCTACCTTTAA13337424TTCATTGACAACATTTTTACTTAAAACTTTATTATAGCTCAAAGT
chrUn_GL343288:1585456-1585470
GTCTTGCTATCACTGCTTACACTGGCACAG1585456TTCATTGACAACATTTCATCCAATGTTTCCAGCCGATGAAGAGAA
chrUn_GL343303:298467-298481
AAGAGGAAGAATTTGGGGTCTAAGTTAATT298467TTCATTGACAACATTTTTTGTGTTCTTTGTTGTATTTCTTTCCAA
chr1:69892575-69892589
CCATGAAAACCTTCCACAACACATTTACCC69892575AATGTTGTCAATGAAGATTTATAGATCTCCAGGAATTAAGGCAGG
chr1:72247048-72247062
TAAATGGATACAGGATTTTAGATCCAATGC72247048AATGTTGTCAATGAATGCATTTCTGATTGTTAGCTCTGAACTTCT
chr5:102888040-102888054
CATACTGAACATTTTAAACAAGAAGATAGA102888040AATGTTGTCAATGAATAAAAACACTCCTCAAAAATTTTGATGAAT
chrUn_GL343236:1522796-1522810
TAAGGTACATTCTTTGTAATTCATCCTGAA1522796AATGTTGTCAATGAAGGAAGACTTGCTGATGAAAGAAGAGTGATC
chrUn_GL343272:1296334-1296348
GTCAGAAAAGTCTGACAACAGAATAAATCC1296334AATGTTGTCAATGAAACTACGAAGCAGTCTGGTGTTGTGGTTTGA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/anoCar2/TTCATTGACAACATT
lang : en | db : anoCar2 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.086 | 0.079 | search_plus_done; http://172.18.8.76:28077/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.099 | 0.013 | search_minus_done; http://172.18.8.76:28077/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=43
0.100 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).