GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2022-12-06 10:51:01, GGGenome : A. gambiae genome, ICSAGA P3/anoGam3 (Nov, 2006)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr2L:30115449-30115463
ACGATTACTTATTTGTCTTAAATTGAAGCA30115449TTCATTGACAACATTTAAAGAAAATACTTTTTGTTGTTACTATTT
chr3R:45062609-45062623
TCCTCCTTCGCTCTCACACACACACACACC45062609TTCATTGACAACATTGGAAACTACACACATTGAGGAAATTTAAAT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/anoGam3/TTCATTGACAACATT
lang : en | db : anoGam3 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.087 | 0.079 | search_plus_done; http://172.18.8.76:28778/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.097 | 0.009 | search_minus_done; http://172.18.8.76:28778/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=48
0.097 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).