GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-03-07 18:28:05, GGGenome : Sea hare genome, Broad 2.0/aplCal1 (Sep, 2008)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

scaffold_37:787145-787159
AAACAAGGTTCGTAGGATAAAGGATTCTTT787145TTCATTGACAACATTCTGTACCGCCTCAAAAAAGAGATTAAGTTT
scaffold_2673:38850-38864
TGTAAAACGGGGCTTTGGTCTTGTTGCTAT38850TTCATTGACAACATTTGTGCGTGTCCACCTCGTAAATAGCCCCGT
scaffold_465:51321-51335
GACATTCTGTTAAAAAAGTGTGAAATCTGT51321AATGTTGTCAATGAACCTTTGTCACCCCTGAGGACTAACTGATCC
scaffold_1155:245389-245403
TTTTTTTTTTTTCCACAAAAGTGCTAGAGG245389AATGTTGTCAATGAAATTCACTTGTAAAAAGTTTCATAAGCATAG
scaffold_1538:70544-70558
TATTTTGATTACAATGAGGCTACTGGGAAG70544AATGTTGTCAATGAAACTGCTGCTGACCTGCGAGACGATAGATCT
scaffold_1946:9302-9316
GTGAGGACAGCTTTAATAGTTGGAGAGAAA9302AATGTTGTCAATGAACCATTTGTGTCGTGGGGAAAAAAATCATCT
scaffold_1957:36689-36703
ATGGTTCACTTTCCAACTTGGCAATAGGCT36689AATGTTGTCAATGAACGGTTGGTCAAGTTGTACTTCCACTTCCAA
scaffold_7633:2518-2532
TATTTTGATTACAATGAGGTTAATGGGAAG2518AATGTTGTCAATGAAACTGCTGCTGACCTGCGTGACGATAAATCT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/aplCal1/TTCATTGACAACATT
lang : en | db : aplCal1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.189 | 0.181 | search_plus_done; http://172.18.8.76:28114/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.199 | 0.010 | search_minus_done; http://172.18.8.76:28114/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=48
0.200 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).