GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-12-08 07:38:03, GGGenome : Minke whale genome, BalAcu1.0/balAcu1 (Oct, 2013)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

KI537401:10893165-10893179
AAATAATGTATCTTAAAATATTCTAAGATA10893165TTCATTGACAACATTTTTAAATGCTCATATTTTTTCACTGGTCTC
KI537429:3633015-3633029
AAAAAAAAGGCCTTTTCTCTATTAAGGACT3633015TTCATTGACAACATTTGGTTTCATTGTGTGCATTAAATCTGTGTT
KI537568:9278486-9278500
GCTCTTTTGTTGTCTACCAAGTTTATTACT9278486TTCATTGACAACATTGCTAGGTATGGACTTTATCTGCTCCAAATC
KI537598:22106049-22106063
TGGAGTTTCTTTAGAGACAGCTAATTAAAG22106049TTCATTGACAACATTGTTGATATTAAAGTGAGCATTCAAAGAAGG
KI537623:783513-783527
CTTCTTATGACTATGGAAGTTTATTTTATA783513TTCATTGACAACATTTTGGAAATTATACATTCTTTTAAACTTTAA
KI537651:11572717-11572731
AAGTAAAGGGATGAATGTAGGCTCAAACTC11572717TTCATTGACAACATTATTTAGGATACCACAATAAATCTAATGGAT
KI537668:2152625-2152639
AGTGTCCTGTTTTTTAAAACTGAAGTATAG2152625TTCATTGACAACATTATATTACTTTCAGGTATACAACATAGTGAT
KI538075:12703691-12703705
ATCATCAGGGTGAAGTTGGCTAGTTGCGGC12703691TTCATTGACAACATTGTTTTGGCCAGGAAGTTTTTCACGCTCTAC
KI538142:7285782-7285796
CTAGAATATATTATCGCTTCAACACAGATT7285782TTCATTGACAACATTCTGTGGGCATTCATTTAATATTAATATCAA
KI538594:5392721-5392735
GAAACAAAGGTCAGAGTTTAAGGAAATTAC5392721TTCATTGACAACATTCAATATTTACTAAATTTCAACTTTATCCTG
KI537176:974800-974814
GGTGTGTGGAGGGAATGTGAGAGATTTTTC974800AATGTTGTCAATGAATGTGTGGAGTCCATTGTTTAAAAAATACAA
KI537922:13548601-13548615
ATATACATTGGAAAGCTTCAAATAAAAAAA13548601AATGTTGTCAATGAAATCTCTTAGAAACCAATGCAAATCTACTTG
KI537937:8187215-8187229
GCTCAATGATCTGAATTTATAACAAGCCCA8187215AATGTTGTCAATGAATCCATACTCTCATCCAGGAATTACACTTCT
KI537979:6426355-6426369
GGAAAAATTTGATAGGAATGGCAATGAAGT6426355AATGTTGTCAATGAACATTGGGGTTGAATTGTGTTAGCACAGCTT
KI538297:3653568-3653582
GAACAGTGGAAACGAGCTATGGATTATTTA3653568AATGTTGTCAATGAACTCAACTACATGACTCAGATTGTTATCATG
KI538341:1633479-1633493
GCCTGTTTTTCACATGCATATGTAATAGTG1633479AATGTTGTCAATGAAAACACAATAGTATTTGGAGTGCAGCATACT
KI538461:1943850-1943864
TCCCACTTAGCCCTATCTAGGCGAAGGAGT1943850AATGTTGTCAATGAATTAATTTTAATTTAGTTACAAATTAAAGAG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/balAcu1/TTCATTGACAACATT
lang : en | db : balAcu1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.081 | 0.074 | search_plus_done; http://172.18.8.77:28044/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.087 | 0.006 | search_minus_done; http://172.18.8.77:28044/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=40
0.089 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).