GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-01 03:06:25, GGGenome : Bison genome, Bison_UMD1.0/bisBis1 (Oct, 2014)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

KN255130v1:21567-21581
GTCATATCAGGGCTAAACTAAAATATAGTG21567TTCATTGACAACATTAGCTGAAGGAAATAAACTGGCTGTCACCCA
KN257712v1:5953-5967
ATCATTTTTCTCCAAAAAATCTACTCCCGC5953TTCATTGACAACATTAAAGCCTTTGACTATGTGGATCACAACAAA
KN264858v1:8770773-8770787
AGAAGTGTAATTACTGGGTCAGAATATGGA8770773TTCATTGACAACATTTGGGCTTGTTAAAAATTCAGGTTATTGAGT
KN265001v1:4827401-4827415
TAGAAGTTCTTAATGTTTGTTTTCTTGGCT4827401TTCATTGACAACATTCCTTTTTGTGTGACCTCATCCACTACCAGC
KN265045v1:7214699-7214713
GGGAATTCCAGAAAAAACATCTACTTCCAT7214699TTCATTGACAACATTAAAGCCTTTGACTCTGTGGGTGAAAAATTC
KN265191v1:2114984-2114998
ACTCCCCTAAATATAAGTCCCATTTCTCCT2114984TTCATTGACAACATTTCAAACAGTATATGTCTTCTGTTTAAATTT
KN264851v1:2097015-2097029
CTCTGACCCACTGTGGCATTCTCACTTCCC2097015AATGTTGTCAATGAACTTCAAACTAAGCTCTGAAGGTCAACTGGC
KN264939v1:3207460-3207474
AATGTCTAGTTAAATGATGCTTTCGTTTTT3207460AATGTTGTCAATGAAACATCTTAAATCTCATTGCTCTGCTCACAG
KN264985v1:9520972-9520986
CAGTGCCTGGCGCACAGTAGGTGTGCAGTA9520972AATGTTGTCAATGAATTGATGGAAGGATGGATGGATGAATTCCGG
KN265015v1:31655-31669
AAGTATAAGAAAGAGTAGGGTGGTGAAGGG31655AATGTTGTCAATGAACCTAATTCAGGATAGAAGCAGAAGCTCTGG
KN265018v1:2900040-2900054
CAACCACAAGAGATAGGCAGAATTTTCATC2900040AATGTTGTCAATGAATAAACTGAAGCAGAGAGAAGTTAAACAAGA
KN265168v1:1601166-1601180
CTTTTCATGAGAATTCTCTACCTTTTAAAA1601166AATGTTGTCAATGAATTTAAAGCAGTGAGTCAGGGGGAGTCACTG
KN265185v1:416262-416276
TGTTTATATGTAACAAATTGGAAAACTTCA416262AATGTTGTCAATGAAATCTCTTAGAAACCAATGCAAATGTACTTG
KN265195v1:399265-399279
GATGTGTGGAGGGAATGAAAGAGATTTTTC399265AATGTTGTCAATGAATGTGTAGAGTCCTTGGTTAAAAACATATAT
KN265205v1:248166-248180
CTTTATTTTCTTTTGCTACAAAGTGTTCGA248166AATGTTGTCAATGAAATGATTACTTTAAAAAAGGCAGATCATTTA
KN265214v1:16898313-16898327
GAACAGTGGAAACGAGCTATGGATTATTTA16898313AATGTTGTCAATGAACTCAACTACATGACTCAGATTGTTATCATG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/bisBis1/TTCATTGACAACATT
lang : en | db : bisBis1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.113 | 0.107 | search_plus_done; http://172.18.8.78:28751/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.122 | 0.009 | search_minus_done; http://172.18.8.78:28751/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=44
0.124 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).