GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-12-01 13:16:22, GGGenome : Silkworm genome, Bmor1 (Apr, 2008)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

nscaf2686 dna:scaffold scaffold:Bmor1:nscaf2686:1:1149164:1
position: 795399-795413
CGGGTAGTGTTATTGTTAGAACATAGGACA795399TTCATTGACAACATTATCAAGATAAGTCTGCCTATACAGGGTGTC
nscaf3048 dna:scaffold scaffold:Bmor1:nscaf3048:1:1752822:1
position: 205021-205035
CGTGATCAAGAAGGACAGGATGTACTGCTC205021TTCATTGACAACATTTTCCGTTTCACTCAGGCTGGATCAGAAGTG
nscaf2970 dna:scaffold scaffold:Bmor1:nscaf2970:1:2780867:1
position: 1552336-1552350
ACAAATCTCAGTAAATTTACTTTAGAATTT1552336TTCATTGACAACATTACGGAGTGAACTAACACAATGATACATAGA
nscaf3034 dna:scaffold scaffold:Bmor1:nscaf3034:1:5106423:1
position: 952690-952704
ACGAATGTTTCCGCTATTTCTGTTAAATTT952690TTCATTGACAACATTGTAGCATACAAGTTTAAAGACTTGCACAGA
nscaf2888 dna:scaffold scaffold:Bmor1:nscaf2888:1:9930683:1
position: 512374-512388
TTCCAGCTCGAAGGTAATATTTTAGTAAAT512374TTCATTGACAACATTTGGTATTCAAGATATACACTATAGTGTGCA
scaffold5214 dna:scaffold scaffold:Bmor1:scaffold5214:1:966:1
position: 420-434
TGGTATAATCCGAGGTTATAGTTAAAAAAA420AATGTTGTCAATGAACCAAAAAATTCAATACTTATTTTACAGTCA
nscaf3048 dna:scaffold scaffold:Bmor1:nscaf3048:1:1752822:1
position: 171480-171494
CACTTCTGATCCAGCCTGAGTGAAACGGAA171480AATGTTGTCAATGAAGAGCAGTACATCCTGTCCTTCTTGATCACG
nscaf2852 dna:scaffold scaffold:Bmor1:nscaf2852:1:2961484:1
position: 984344-984358
CTTTTTTGTTTTAAACTACAAAGAAGCCTT984344AATGTTGTCAATGAAATTTTTTAAAACAGGTTAGGGTTGTCTAAT
nscaf1681 dna:scaffold scaffold:Bmor1:nscaf1681:1:5888100:1
position: 2906704-2906718
CAATAAAATATCTCGTATTATGATGACAGT2906704AATGTTGTCAATGAAATGGTAGTTTTAAACATAAATGTCGTTTGT
nscaf1681 dna:scaffold scaffold:Bmor1:nscaf1681:1:5888100:1
position: 3848504-3848518
AGTTGAATCAATCTGTATAGTTTATAAGTG3848504AATGTTGTCAATGAAATAGTATTATAATAGGCTACTTCAGATTAT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/bmor1/TTCATTGACAACATT
lang : en | db : bmor1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.090 | 0.082 | search_plus_done; http://172.18.8.76:28221/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.102 | 0.012 | search_minus_done; http://172.18.8.76:28221/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=45
0.105 | 0.003 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).