GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-01 01:56:57, GGGenome : Marmoset genome, WUGSC 3.2/calJac3 (Mar, 2009)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr4:83483837-83483851
TGTCTCATTTGAAGTTTGTTTTTACTTGAA83483837TTCATTGACAACATTATACAATCTGAAAACTACATAAAACCTAAA
chr7:49423688-49423702
TCACTCACCAGGAGGCTGCTGAGAAAACAG49423688TTCATTGACAACATTGCCCATGAAGATGCCAACTCGAGTCTCATT
chr10:49868671-49868685
CAGAAATTTTGGAAATGCTACTGTTGCTTT49868671TTCATTGACAACATTAGCTGGGACTGTATTAAATATCAAATATAT
chr1:30386675-30386689
GTTGTCACCTCAGTGTGAGTTACCTCAGGC30386675AATGTTGTCAATGAATACAGCCTCCAGGGAGAAACTTCAGACTGC
chr2:17110386-17110400
CTTCTCAGGCAATTATTTGTTGAATGAACC17110386AATGTTGTCAATGAAGCTAATGTGCTGACTCAGGCCAGGCACCAC
chr2:158780935-158780949
AAAACTTGCATAGTTTGTTACACAGTTATT158780935AATGTTGTCAATGAAATAATAGCAATGTAAATTAAGAAGACTTAA
chr3:25538741-25538755
TGTAGTCAGCAAATAGTTAATTGCTGTTTA25538741AATGTTGTCAATGAAAAGGAGTATTACACAAAATCAGAGGATTTA
chr3:81071012-81071026
ATATGAAAATTCAATAAAAGTACATTACAA81071012AATGTTGTCAATGAAATTGTAATTATTTTTCAGACTATGACATTA
chr4:229545-229559
TTGGCTCACGTTTCTCTTTTGGGTGGTGTT229545AATGTTGTCAATGAAAAGAGTCAAACTCTGTAAAATATTTGAAAG
chr5:115809822-115809836
AAATGCTTCCAGCTTTTACCCATTCAGCAT115809822AATGTTGTCAATGAACCCATTGGATGGCTCTTATTTTGAGATATG
chr6:58621786-58621800
AAGTTCCAAAGTAAATTTGCATTATATGCT58621786AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
chr9:81809951-81809965
AACCCTCTCCTGTAGAATTTCTTTCCATGA81809951AATGTTGTCAATGAAAAAGAATGAAAAGTCATGTAGATTCATGTA
chr10:32711328-32711342
GAAAAAAAACCCAGAACTTTTAAAATGAAA32711328AATGTTGTCAATGAAACTAAAAATATCTTGGACAAGTTTAACATA
chr11:39368029-39368043
CACACAAAGCCATGCTTCCTGAATCCATAA39368029AATGTTGTCAATGAAATGGTTAAAATTGTTGTATATATTGTGTCC
chr13:13566825-13566839
TCTGAGACATGACACCTGGGTTTAGATCCT13566825AATGTTGTCAATGAACACAACTTCTTTGGTCATTCCCAATATATT
chr19:11468049-11468063
ATTCATGGTTTGTCACCTAGTTTTGTTGGA11468049AATGTTGTCAATGAATTTATTTTGCTATCCAGTTTCTCCGTATGC
chrX:105531811-105531825
TATGCCTTTCTCTTAATGTACAAGTAAATA105531811AATGTTGTCAATGAAATGGGAATTTTTATTGGGTTGGGGATTTGT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/calJac3/TTCATTGACAACATT
lang : en | db : calJac3 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.078 | 0.072 | search_plus_done; http://172.18.8.78:28041/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.084 | 0.005 | search_minus_done; http://172.18.8.78:28041/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=47
0.086 | 0.003 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).